EMAIL THIS PAGE TO A FRIEND

AP3B1

adaptor-related protein complex 3, beta 1 subunit

101 Gene Product Result for
Synonyms: ADTB3 ADTB3A HPS HPS2 PE
UniProtKB ID: O00203, O00580, Q7Z393, Q9HD66
Gene ID:
Human(8546) Summary: This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. The encoded protein is part of the heterotetrameric AP-3 protein complex which interacts with the scaffolding protein clathrin. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2012]
Mouse(11774) adaptor-related protein complex 3, beta 1 subunit
Rat(309969) adaptor-related protein complex 3, beta 1 subunit
chicken(427646) adaptor-related protein complex 3, beta 1 subunit
domestic cat(101084165) adaptor-related protein complex 3, beta 1 subunit
cow(767602) adaptor-related protein complex 3, beta 1 subunit
Horse(100065436) adaptor-related protein complex 3, beta 1 subunit
dog(403459) adaptor-related protein complex 3, beta 1 subunit
sheep(101112650) adaptor-related protein complex 3, beta 1 subunit
domestic guinea pig(100723794) adaptor-related protein complex 3, beta 1 subunit
naked mole-rat(101701726) adaptor-related protein complex 3, beta 1 subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009680 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009680 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009680 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003664 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003664 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003664 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU010611 MISSION® esiRNA esiRNA targeting human AP3B1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003664 Rosetta Predictions human pricing
NM_001107646 Rosetta Predictions rat pricing
NM_009680 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003664 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018424 predicted 2434
2 SASI_Hs01_00018425 predicted 560
3 SASI_Hs01_00018426 predicted 281
4 SASI_Hs01_00018427 predicted 809
5 SASI_Hs01_00018428 predicted 801
6 SASI_Hs01_00018429 predicted 1155
7 SASI_Hs01_00018431 predicted 1495
8 SASI_Hs02_00336045 predicted 1411
9 SASI_Hs01_00018432 predicted 229
10 SASI_Hs01_00018433 predicted 758
11 SASI_Hs01_00018430 predicted 867
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107646 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230885 predicted 2362
2 SASI_Rn02_00230886 predicted 1499
3 SASI_Rn02_00230887 predicted 1545
4 SASI_Rn02_00230888 predicted 2721
5 SASI_Rn02_00230889 predicted 1561
6 SASI_Rn02_00230890 predicted 1028
7 SASI_Rn02_00230891 predicted 998
8 SASI_Rn02_00230892 predicted 2785
9 SASI_Rn02_00230893 predicted 2316
10 SASI_Rn02_00230894 predicted 1069
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009680 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054318 predicted 3479
2 SASI_Mm01_00054319 predicted 645
3 SASI_Mm01_00054320 predicted 2886
4 SASI_Mm01_00054322 predicted 2641
5 SASI_Mm02_00316748 predicted 1581
6 SASI_Mm01_00054324 predicted 1334
7 SASI_Mm01_00054325 predicted 429
8 SASI_Mm01_00054326 predicted 1224
9 SASI_Mm01_00054327 predicted 2665
10 SASI_Mm02_00316749 predicted 1862
11 SASI_Mm01_00054321 predicted 1836
12 SASI_Mm01_00054323 predicted 1303
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009680
VALIDATED
AP3B1 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 3, beta 1 subunit
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009680.2-2024s1c1
Sequence:CCGGCGGTTCGCAATGTAGAAGTAACTCGAGTTACTTCTACATTGCGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009680.2-726s1c1
Sequence:CCGGCCCGGATAGAATCGATCTGATCTCGAGATCAGATCGATTCTATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100440    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009680.2-3719s1c1
Sequence:CCGGGCTTGGCAATCGTCCTTCTTACTCGAGTAAGAAGGACGATTGCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009680.2-1431s1c1
Sequence:CCGGGCTGTCCAACAGGGATGAAATCTCGAGATTTCATCCCTGTTGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009680.2-727s1c1
Sequence:CCGGCCGGATAGAATCGATCTGATTCTCGAGAATCAGATCGATTCTATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009680.3-1155s21c1
Sequence:GTACCGGTAAATCACTGGTGCGCTTATTCTCGAGAATAAGCGCACCAGTGATTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009680.3-439s21c1
Sequence:GTACCGGTACGTTTACCTTGTCCGATATCTCGAGATATCGGACAAGGTAAACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302757    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009680.3-3782s21c1
Sequence:CCGGGCTTGGCAATCGTCCTTCTTACTCGAGTAAGAAGGACGATTGCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009680.3-1637s21c1
Sequence:CCGGCAAGCATCCTTTGGCTAATTGCTCGAGCAATTAGCCAAAGGATGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009680.3-1097s21c1
Sequence:CCGGTGGCTGTCGCTCAGCTATATTCTCGAGAATATAGCTGAGCGACAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009680.3-591s21c1
Sequence:CCGGTGTCATGATGCTGGCTATTAACTCGAGTTAATAGCCAGCATCATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009680.3-1279s21c1
Sequence:CCGGAGATCCACTGATCCAACTATGCTCGAGCATAGTTGGATCAGTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009680.3-2883s21c1
Sequence:GTACCGGACAGATCACCCTGACTAATACCTCGAGGTATTAGTCAGGGTGATCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009680
VALIDATED
AP3B1 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 3, beta 1 subunit
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009680.2-2024s1c1
Sequence:CCGGCGGTTCGCAATGTAGAAGTAACTCGAGTTACTTCTACATTGCGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009680.2-726s1c1
Sequence:CCGGCCCGGATAGAATCGATCTGATCTCGAGATCAGATCGATTCTATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100440    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009680.2-3719s1c1
Sequence:CCGGGCTTGGCAATCGTCCTTCTTACTCGAGTAAGAAGGACGATTGCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009680.2-1431s1c1
Sequence:CCGGGCTGTCCAACAGGGATGAAATCTCGAGATTTCATCCCTGTTGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009680.2-727s1c1
Sequence:CCGGCCGGATAGAATCGATCTGATTCTCGAGAATCAGATCGATTCTATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009680.3-1155s21c1
Sequence:GTACCGGTAAATCACTGGTGCGCTTATTCTCGAGAATAAGCGCACCAGTGATTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009680.3-439s21c1
Sequence:GTACCGGTACGTTTACCTTGTCCGATATCTCGAGATATCGGACAAGGTAAACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302757    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009680.3-3782s21c1
Sequence:CCGGGCTTGGCAATCGTCCTTCTTACTCGAGTAAGAAGGACGATTGCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009680.3-1637s21c1
Sequence:CCGGCAAGCATCCTTTGGCTAATTGCTCGAGCAATTAGCCAAAGGATGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009680.3-1097s21c1
Sequence:CCGGTGGCTGTCGCTCAGCTATATTCTCGAGAATATAGCTGAGCGACAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009680.3-591s21c1
Sequence:CCGGTGTCATGATGCTGGCTATTAACTCGAGTTAATAGCCAGCATCATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009680.3-1279s21c1
Sequence:CCGGAGATCCACTGATCCAACTATGCTCGAGCATAGTTGGATCAGTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009680.3-2883s21c1
Sequence:GTACCGGACAGATCACCCTGACTAATACCTCGAGGTATTAGTCAGGGTGATCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009680
VALIDATED
AP3B1 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 3, beta 1 subunit
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009680.2-2024s1c1
Sequence:CCGGCGGTTCGCAATGTAGAAGTAACTCGAGTTACTTCTACATTGCGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009680.2-726s1c1
Sequence:CCGGCCCGGATAGAATCGATCTGATCTCGAGATCAGATCGATTCTATCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100440    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009680.2-3719s1c1
Sequence:CCGGGCTTGGCAATCGTCCTTCTTACTCGAGTAAGAAGGACGATTGCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009680.2-1431s1c1
Sequence:CCGGGCTGTCCAACAGGGATGAAATCTCGAGATTTCATCCCTGTTGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009680.2-727s1c1
Sequence:CCGGCCGGATAGAATCGATCTGATTCTCGAGAATCAGATCGATTCTATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009680.3-1155s21c1
Sequence:GTACCGGTAAATCACTGGTGCGCTTATTCTCGAGAATAAGCGCACCAGTGATTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009680.3-439s21c1
Sequence:GTACCGGTACGTTTACCTTGTCCGATATCTCGAGATATCGGACAAGGTAAACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302757    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009680.3-3782s21c1
Sequence:CCGGGCTTGGCAATCGTCCTTCTTACTCGAGTAAGAAGGACGATTGCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009680.3-1637s21c1
Sequence:CCGGCAAGCATCCTTTGGCTAATTGCTCGAGCAATTAGCCAAAGGATGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009680.3-1097s21c1
Sequence:CCGGTGGCTGTCGCTCAGCTATATTCTCGAGAATATAGCTGAGCGACAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009680.3-591s21c1
Sequence:CCGGTGTCATGATGCTGGCTATTAACTCGAGTTAATAGCCAGCATCATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009680.3-1279s21c1
Sequence:CCGGAGATCCACTGATCCAACTATGCTCGAGCATAGTTGGATCAGTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009680.3-2883s21c1
Sequence:GTACCGGACAGATCACCCTGACTAATACCTCGAGGTATTAGTCAGGGTGATCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003664
VALIDATED
AP3B1 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 3, beta 1 subunit
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065058    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_003664.3-3811s1c1
Sequence:CCGGCCTCTCAGCTTGGTATGTGAACTCGAGTTCACATACCAAGCTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003664.3-1614s1c1
Sequence:CCGGGCAAGTATTCTTTGGCTAATTCTCGAGAATTAGCCAAAGAATACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003664.3-3239s1c1
Sequence:CCGGCCAGGATAATATACACAGGTTCTCGAGAACCTGTGTATATTATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003664.3-2712s1c1
Sequence:CCGGCCTGCATTTGTACCAACGAAACTCGAGTTTCGTTGGTACAAATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003664.3-1389s1c1
Sequence:CCGGGCAGCCACTATTCAGACTATACTCGAGTATAGTCTGAATAGTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003664.3-499s21c1
Sequence:GTACCGGAGGACCCAAACCAACTAATTCCTCGAGGAATTAGTTGGTTTGGGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003664.3-1389s21c1
Sequence:CCGGGCAGCCACTATTCAGACTATACTCGAGTATAGTCTGAATAGTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003664.3-2712s21c1
Sequence:CCGGCCTGCATTTGTACCAACGAAACTCGAGTTTCGTTGGTACAAATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_003664.3-1614s21c1
Sequence:CCGGGCAAGTATTCTTTGGCTAATTCTCGAGAATTAGCCAAAGAATACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293164    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003664.3-3604s21c1
Sequence:CCGGTGCTAACCAAAGAGCATATATCTCGAGATATATGCTCTTTGGTTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003664.3-2765s21c1
Sequence:CCGGAGGACTAGCTGCCCATTATTTCTCGAGAAATAATGGGCAGCTAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003664.3-402s21c1
Sequence:GTACCGGGAGATCAAGAAGTTGGTATATCTCGAGATATACCAACTTCTTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003664
VALIDATED
AP3B1 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 3, beta 1 subunit
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065058    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_003664.3-3811s1c1
Sequence:CCGGCCTCTCAGCTTGGTATGTGAACTCGAGTTCACATACCAAGCTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003664.3-1614s1c1
Sequence:CCGGGCAAGTATTCTTTGGCTAATTCTCGAGAATTAGCCAAAGAATACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003664.3-3239s1c1
Sequence:CCGGCCAGGATAATATACACAGGTTCTCGAGAACCTGTGTATATTATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003664.3-2712s1c1
Sequence:CCGGCCTGCATTTGTACCAACGAAACTCGAGTTTCGTTGGTACAAATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003664.3-1389s1c1
Sequence:CCGGGCAGCCACTATTCAGACTATACTCGAGTATAGTCTGAATAGTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003664.3-499s21c1
Sequence:GTACCGGAGGACCCAAACCAACTAATTCCTCGAGGAATTAGTTGGTTTGGGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003664.3-1389s21c1
Sequence:CCGGGCAGCCACTATTCAGACTATACTCGAGTATAGTCTGAATAGTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003664.3-2712s21c1
Sequence:CCGGCCTGCATTTGTACCAACGAAACTCGAGTTTCGTTGGTACAAATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_003664.3-1614s21c1
Sequence:CCGGGCAAGTATTCTTTGGCTAATTCTCGAGAATTAGCCAAAGAATACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293164    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003664.3-3604s21c1
Sequence:CCGGTGCTAACCAAAGAGCATATATCTCGAGATATATGCTCTTTGGTTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003664.3-2765s21c1
Sequence:CCGGAGGACTAGCTGCCCATTATTTCTCGAGAAATAATGGGCAGCTAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003664.3-402s21c1
Sequence:GTACCGGGAGATCAAGAAGTTGGTATATCTCGAGATATACCAACTTCTTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003664
VALIDATED
AP3B1 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 3, beta 1 subunit
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065058    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_003664.3-3811s1c1
Sequence:CCGGCCTCTCAGCTTGGTATGTGAACTCGAGTTCACATACCAAGCTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003664.3-1614s1c1
Sequence:CCGGGCAAGTATTCTTTGGCTAATTCTCGAGAATTAGCCAAAGAATACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003664.3-3239s1c1
Sequence:CCGGCCAGGATAATATACACAGGTTCTCGAGAACCTGTGTATATTATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003664.3-2712s1c1
Sequence:CCGGCCTGCATTTGTACCAACGAAACTCGAGTTTCGTTGGTACAAATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003664.3-1389s1c1
Sequence:CCGGGCAGCCACTATTCAGACTATACTCGAGTATAGTCTGAATAGTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003664.3-499s21c1
Sequence:GTACCGGAGGACCCAAACCAACTAATTCCTCGAGGAATTAGTTGGTTTGGGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003664.3-1389s21c1
Sequence:CCGGGCAGCCACTATTCAGACTATACTCGAGTATAGTCTGAATAGTGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003664.3-2712s21c1
Sequence:CCGGCCTGCATTTGTACCAACGAAACTCGAGTTTCGTTGGTACAAATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_003664.3-1614s21c1
Sequence:CCGGGCAAGTATTCTTTGGCTAATTCTCGAGAATTAGCCAAAGAATACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293164    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003664.3-3604s21c1
Sequence:CCGGTGCTAACCAAAGAGCATATATCTCGAGATATATGCTCTTTGGTTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003664.3-2765s21c1
Sequence:CCGGAGGACTAGCTGCCCATTATTTCTCGAGAAATAATGGGCAGCTAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003664.3-402s21c1
Sequence:GTACCGGGAGATCAAGAAGTTGGTATATCTCGAGATATACCAACTTCTTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks