EMAIL THIS PAGE TO A FRIEND

AP3B2

adaptor-related protein complex 3, beta 2 subunit

47 Gene Product Result for
Synonyms: NAPTB
UniProtKB ID: Q13367, A4Z4T7, O14808, Q52LY8
Gene ID:
Human(8120) Summary: Adaptor protein-3 (AP3) is a heterotetrameric vesicle-coat protein complex. Some AP3 subunits are ubiquitously expressed, whereas others are expressed exclusively in neurons. The neuron-specific AP3 complex, which includes AP3B2, is thought to serve neuron-specific functions such as neurotransmitter release (Grabner et al., 2006 [PubMed 16788073]
Mouse(11775) adaptor-related protein complex 3, beta 2 subunit
Rat(308777) adaptor-related protein complex 3, beta 2 subunit
Zebrafish(100000165) adaptor-related protein complex 3, beta 2 subunit
cow(784163) adaptor-related protein complex 3, beta 2 subunit
chicken(769343) adaptor-related protein complex 3, beta 2 subunit
domestic cat(101097898) adaptor-related protein complex 3, beta 2 subunit
dog(479053) adaptor-related protein complex 3, beta 2 subunit
naked mole-rat(101701517) adaptor-related protein complex 3, beta 2 subunit
domestic guinea pig(100730944) adaptor-related protein complex 3, beta 2 subunit
sheep(101105605) adaptor-related protein complex 3, beta 2 subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021492 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021492 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021492 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004644 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004644 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004644 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU013091 MISSION® esiRNA esiRNA targeting mouse Ap3b2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004644 Rosetta Predictions human pricing
NM_001107532 Rosetta Predictions rat pricing
NM_021492 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004644 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239442 predicted 1620
2 SASI_Hs01_00239443 predicted 1422
3 SASI_Hs01_00239444 predicted 1872
4 SASI_Hs01_00239446 predicted 2000
5 SASI_Hs01_00239447 predicted 1795
6 SASI_Hs01_00239448 predicted 1467
7 SASI_Hs01_00239449 predicted 2964
8 SASI_Hs01_00239450 predicted 419
9 SASI_Hs01_00239451 predicted 886
10 SASI_Hs02_00338053 predicted 3044
11 SASI_Hs01_00239445 predicted 1449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107532 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229755 predicted 346
2 SASI_Rn02_00229756 predicted 285
3 SASI_Rn02_00229757 predicted 536
4 SASI_Rn02_00229758 predicted 383
5 SASI_Rn02_00229759 predicted 312
6 SASI_Rn02_00229760 predicted 194
7 SASI_Rn02_00229761 predicted 564
8 SASI_Rn02_00229762 predicted 497
9 SASI_Rn02_00229763 predicted 328
10 SASI_Rn02_00229764 predicted 425
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021492 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113908 predicted 3103
2 SASI_Mm01_00113909 predicted 3357
3 SASI_Mm02_00326186 predicted 383
4 SASI_Mm01_00113910 predicted 1749
5 SASI_Mm01_00113911 predicted 1011
6 SASI_Mm02_00326187 predicted 543
7 SASI_Mm01_00113912 predicted 3129
8 SASI_Mm01_00113913 predicted 918
9 SASI_Mm01_00113915 predicted 3560
10 SASI_Mm01_00113916 predicted 825
11 SASI_Mm01_00113914 predicted 3358
12 SASI_Mm01_00113917 predicted 2964
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021492
VALIDATED
AP3B2 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 3, beta 2 subunit
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021492.3-2283s21c1
Sequence:GTACCGGGAATGGACCAAATGTTCAAATCTCGAGATTTGAACATTTGGTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021492.3-1178s21c1
Sequence:GTACCGGCGCTCGGAAGCCCTATGTAATCTCGAGATTACATAGGGCTTCCGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021492.3-1696s21c1
Sequence:CCGGCAGAGTCAGTGGTGGTCATTACTCGAGTAATGACCACCACTGACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287130    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021492.3-3562s21c1
Sequence:CCGGGCACTGTTACCCACTGATCTTCTCGAGAAGATCAGTGGGTAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021492.3-1606s21c1
Sequence:CCGGGACGATGTGCAACGAACATAGCTCGAGCTATGTTCGTTGCACATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021492.3-585s21c1
Sequence:CCGGTACGTGTATCTGGTCCGATATCTCGAGATATCGGACCAGATACACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021492.3-1038s21c1
Sequence:CCGGCGTTATGCGCGAACGCAATTCCTCGAGGAATTGCGTTCGCGCATAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021492.3-3106s21c1
Sequence:GTACCGGCCACTACTGTGATGGGCATTACTCGAGTAATGCCCATCACAGTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021492.2-3343s1c1
Sequence:CCGGGCACTGTTACCCACTGATCTTCTCGAGAAGATCAGTGGGTAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021492.2-969s1c1
Sequence:CCGGCCCTATGTAATGGACCCAGATCTCGAGATCTGGGTCCATTACATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021492.2-717s1c1
Sequence:CCGGCCAGAACGTATTGACCTGATTCTCGAGAATCAGGTCAATACGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021492.2-1930s1c1
Sequence:CCGGCCTTCAAAGATCGTGACCATTCTCGAGAATGGTCACGATCTTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021492.2-3006s1c1
Sequence:CCGGCCTGTATTTATGAGTGAGAATCTCGAGATTCTCACTCATAAATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021492
VALIDATED
AP3B2 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 3, beta 2 subunit
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021492.3-2283s21c1
Sequence:GTACCGGGAATGGACCAAATGTTCAAATCTCGAGATTTGAACATTTGGTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021492.3-1178s21c1
Sequence:GTACCGGCGCTCGGAAGCCCTATGTAATCTCGAGATTACATAGGGCTTCCGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021492.3-1696s21c1
Sequence:CCGGCAGAGTCAGTGGTGGTCATTACTCGAGTAATGACCACCACTGACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287130    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021492.3-3562s21c1
Sequence:CCGGGCACTGTTACCCACTGATCTTCTCGAGAAGATCAGTGGGTAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021492.3-1606s21c1
Sequence:CCGGGACGATGTGCAACGAACATAGCTCGAGCTATGTTCGTTGCACATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021492.3-585s21c1
Sequence:CCGGTACGTGTATCTGGTCCGATATCTCGAGATATCGGACCAGATACACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021492.3-1038s21c1
Sequence:CCGGCGTTATGCGCGAACGCAATTCCTCGAGGAATTGCGTTCGCGCATAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021492.3-3106s21c1
Sequence:GTACCGGCCACTACTGTGATGGGCATTACTCGAGTAATGCCCATCACAGTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021492.2-3343s1c1
Sequence:CCGGGCACTGTTACCCACTGATCTTCTCGAGAAGATCAGTGGGTAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021492.2-969s1c1
Sequence:CCGGCCCTATGTAATGGACCCAGATCTCGAGATCTGGGTCCATTACATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021492.2-717s1c1
Sequence:CCGGCCAGAACGTATTGACCTGATTCTCGAGAATCAGGTCAATACGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021492.2-1930s1c1
Sequence:CCGGCCTTCAAAGATCGTGACCATTCTCGAGAATGGTCACGATCTTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021492.2-3006s1c1
Sequence:CCGGCCTGTATTTATGAGTGAGAATCTCGAGATTCTCACTCATAAATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021492
VALIDATED
AP3B2 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 3, beta 2 subunit
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021492.3-2283s21c1
Sequence:GTACCGGGAATGGACCAAATGTTCAAATCTCGAGATTTGAACATTTGGTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021492.3-1178s21c1
Sequence:GTACCGGCGCTCGGAAGCCCTATGTAATCTCGAGATTACATAGGGCTTCCGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021492.3-1696s21c1
Sequence:CCGGCAGAGTCAGTGGTGGTCATTACTCGAGTAATGACCACCACTGACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287130    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021492.3-3562s21c1
Sequence:CCGGGCACTGTTACCCACTGATCTTCTCGAGAAGATCAGTGGGTAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021492.3-1606s21c1
Sequence:CCGGGACGATGTGCAACGAACATAGCTCGAGCTATGTTCGTTGCACATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021492.3-585s21c1
Sequence:CCGGTACGTGTATCTGGTCCGATATCTCGAGATATCGGACCAGATACACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021492.3-1038s21c1
Sequence:CCGGCGTTATGCGCGAACGCAATTCCTCGAGGAATTGCGTTCGCGCATAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021492.3-3106s21c1
Sequence:GTACCGGCCACTACTGTGATGGGCATTACTCGAGTAATGCCCATCACAGTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021492.2-3343s1c1
Sequence:CCGGGCACTGTTACCCACTGATCTTCTCGAGAAGATCAGTGGGTAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021492.2-969s1c1
Sequence:CCGGCCCTATGTAATGGACCCAGATCTCGAGATCTGGGTCCATTACATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021492.2-717s1c1
Sequence:CCGGCCAGAACGTATTGACCTGATTCTCGAGAATCAGGTCAATACGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021492.2-1930s1c1
Sequence:CCGGCCTTCAAAGATCGTGACCATTCTCGAGAATGGTCACGATCTTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021492.2-3006s1c1
Sequence:CCGGCCTGTATTTATGAGTGAGAATCTCGAGATTCTCACTCATAAATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004644
AP3B2 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 3, beta 2 subunit
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004644.3-1379s21c1
Sequence:CCGGTGGCCAATGAGACCAACATTCCTCGAGGAATGTTGGTCTCATTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004644.3-1568s21c1
Sequence:CCGGCAGAGTCAGTGGTCGTCATTACTCGAGTAATGACGACCACTGACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242593    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004644.3-3443s21c1
Sequence:CCGGCCTGTTTGGCTCCCATCTATACTCGAGTATAGATGGGAGCCAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004644.3-1474s21c1
Sequence:CCGGATTGGACGCTGTGCAACTAACCTCGAGGTTAGTTGCACAGCGTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004644.3-2931s21c1
Sequence:CCGGCATCCAAGAATTTCCCGAAATCTCGAGATTTCGGGAAATTCTTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004644.3-2981s1c1
Sequence:CCGGCTGCTGTAATGGGCATTAATTCTCGAGAATTAATGCCCATTACAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181023    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004644.3-2978s1c1
Sequence:CCGGCCACTGCTGTAATGGGCATTACTCGAGTAATGCCCATTACAGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004644.3-2930s1c1
Sequence:CCGGGCATCCAAGAATTTCCCGAAACTCGAGTTTCGGGAAATTCTTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004644
AP3B2 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 3, beta 2 subunit
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004644.3-1379s21c1
Sequence:CCGGTGGCCAATGAGACCAACATTCCTCGAGGAATGTTGGTCTCATTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004644.3-1568s21c1
Sequence:CCGGCAGAGTCAGTGGTCGTCATTACTCGAGTAATGACGACCACTGACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242593    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004644.3-3443s21c1
Sequence:CCGGCCTGTTTGGCTCCCATCTATACTCGAGTATAGATGGGAGCCAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004644.3-1474s21c1
Sequence:CCGGATTGGACGCTGTGCAACTAACCTCGAGGTTAGTTGCACAGCGTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004644.3-2931s21c1
Sequence:CCGGCATCCAAGAATTTCCCGAAATCTCGAGATTTCGGGAAATTCTTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004644.3-2981s1c1
Sequence:CCGGCTGCTGTAATGGGCATTAATTCTCGAGAATTAATGCCCATTACAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181023    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004644.3-2978s1c1
Sequence:CCGGCCACTGCTGTAATGGGCATTACTCGAGTAATGCCCATTACAGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004644.3-2930s1c1
Sequence:CCGGGCATCCAAGAATTTCCCGAAACTCGAGTTTCGGGAAATTCTTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004644
AP3B2 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 3, beta 2 subunit
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004644.3-1379s21c1
Sequence:CCGGTGGCCAATGAGACCAACATTCCTCGAGGAATGTTGGTCTCATTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004644.3-1568s21c1
Sequence:CCGGCAGAGTCAGTGGTCGTCATTACTCGAGTAATGACGACCACTGACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242593    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004644.3-3443s21c1
Sequence:CCGGCCTGTTTGGCTCCCATCTATACTCGAGTATAGATGGGAGCCAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004644.3-1474s21c1
Sequence:CCGGATTGGACGCTGTGCAACTAACCTCGAGGTTAGTTGCACAGCGTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004644.3-2931s21c1
Sequence:CCGGCATCCAAGAATTTCCCGAAATCTCGAGATTTCGGGAAATTCTTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004644.3-2981s1c1
Sequence:CCGGCTGCTGTAATGGGCATTAATTCTCGAGAATTAATGCCCATTACAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181023    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004644.3-2978s1c1
Sequence:CCGGCCACTGCTGTAATGGGCATTACTCGAGTAATGCCCATTACAGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004644.3-2930s1c1
Sequence:CCGGGCATCCAAGAATTTCCCGAAACTCGAGTTTCGGGAAATTCTTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks