EMAIL THIS PAGE TO A FRIEND

AP3D1

adaptor-related protein complex 3, delta 1 subunit

84 Gene Product Result for
Synonyms: ADTD hBLVR
UniProtKB ID: O14617, O00202, O75262, Q59HF5, Q96G11, Q9H3C6
Gene ID:
Human(8943) Summary: The protein encoded by this gene is a subunit of the AP3 adaptor-like complex, which is not clathrin-associated, but is associated with the golgi region, as well as more peripheral structures. The AP-3 complex facilitates the budding of vesicles from the golgi membrane, and may be directly involved in trafficking to lysosomes. This subunit is implicated in intracellular biogenesis and trafficking of pigment granules, and possibly platelet dense granules and neurotransmitter vesicles. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
Mouse(11776) adaptor-related protein complex 3, delta 1 subunit
Rat(314633) adaptor-related protein complex 3, delta 1 subunit
sheep(101121852) adaptor-related protein complex 3, delta 1 subunit
domestic guinea pig(100713315) adaptor-related protein complex 3, delta 1 subunit
naked mole-rat(101713323) adaptor-related protein complex 3, delta 1 subunit
Zebrafish(563359) adaptor-related protein complex 3, delta 1 subunit
chicken(420079) adaptor-related protein complex 3, delta 1 subunit
cow(281023) adaptor-related protein complex 3, delta 1 subunit
domestic cat(101100946) adaptor-related protein complex 3, delta 1 subunit
dog(476750) adaptor-related protein complex 3, delta 1 subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2900325 Anti-AP3D1 antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
HPA074408 Anti-AP3D1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007460 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007460 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007460 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003938 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003938 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003938 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU080241 MISSION® esiRNA esiRNA human AP3D1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077523 Rosetta Predictions human pricing
NM_003938 Rosetta Predictions human pricing
NM_001100719 Rosetta Predictions rat pricing
NM_007460 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077523 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312934 predicted 392
2 SASI_Hs02_00312935 predicted 479
3 SASI_Hs02_00312936 predicted 1722
4 SASI_Hs02_00312937 predicted 1508
5 SASI_Hs02_00312938 predicted 472
6 SASI_Hs02_00312939 predicted 3505
7 SASI_Hs02_00312940 predicted 3288
8 SASI_Hs02_00312941 predicted 3324
9 SASI_Hs02_00312942 predicted 3651
10 SASI_Hs02_00312943 predicted 1165
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003938 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336583 predicted 396
2 SASI_Hs01_00049525 predicted 480
3 SASI_Hs02_00336584 predicted 1999
4 SASI_Hs02_00336585 predicted 1778
5 SASI_Hs01_00049526 predicted 476
6 SASI_Hs02_00336586 predicted 3630
7 SASI_Hs01_00049527 predicted 3415
8 SASI_Hs02_00336587 predicted 3444
9 SASI_Hs02_00336588 predicted 3771
10 SASI_Hs02_00336589 predicted 1432
11 SASI_Hs01_00049524 predicted 414
12 SASI_Hs01_00049528 predicted 453
13 SASI_Hs01_00049529 predicted 3567
14 SASI_Hs01_00049530 predicted 1358
15 SASI_Hs01_00049531 predicted 721
16 SASI_Hs01_00049532 predicted 3331
17 SASI_Hs01_00049533 predicted 1135
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100719 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210378 predicted 3594
2 SASI_Rn02_00210379 predicted 3148
3 SASI_Rn02_00210380 predicted 927
4 SASI_Rn02_00210381 predicted 242
5 SASI_Rn02_00210382 predicted 545
6 SASI_Rn02_00210383 predicted 496
7 SASI_Rn02_00210384 predicted 3387
8 SASI_Rn02_00210385 predicted 3607
9 SASI_Rn02_00210386 predicted 3885
10 SASI_Rn02_00210387 predicted 252
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007460 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176670 predicted 655
2 SASI_Mm02_00311651 predicted 3561
3 SASI_Mm01_00176671 predicted 712
4 SASI_Mm01_00176672 predicted 1647
5 SASI_Mm01_00176673 predicted 3413
6 SASI_Mm01_00176675 predicted 483
7 SASI_Mm01_00176676 predicted 238
8 SASI_Mm01_00176677 predicted 3360
9 SASI_Mm01_00176678 predicted 1132
10 SASI_Mm01_00176679 predicted 1055
11 SASI_Mm01_00176674 predicted 1769
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007460
AP3D1 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 3, delta 1 subunit
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201931    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007460.1-1051s1c1
Sequence:CCGGCGAGTGTGTGAACACCGTAATCTCGAGATTACGGTGTTCACACACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191335    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007460.1-4156s1c1
Sequence:CCGGCCACAAATATTCCAACTGGTACTCGAGTACCAGTTGGAATATTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190160    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007460.1-250s1c1
Sequence:CCGGCGACCGCATGTTCGATAAGAACTCGAGTTCTTATCGAACATGCGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007460.1-3570s1c1
Sequence:CCGGCCATCAAAGTCGATGGCATTACTCGAGTAATGCCATCGACTTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007460.1-3671s21c1
Sequence:CCGGTCCATGTACAGCCGCTCTATCCTCGAGGATAGAGCGGCTGTACATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007460.1-2085s21c1
Sequence:CCGGACCTGGATGCCTGGATCAATGCTCGAGCATTGATCCAGGCATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007460.1-1053s21c1
Sequence:CCGGAGTGTGTGAACACCGTAATTGCTCGAGCAATTACGGTGTTCACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240521    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007460.1-4145s21c1
Sequence:CCGGGATGCTGCTGTCCACAAATATCTCGAGATATTTGTGGACAGCAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007460.1-3143s21c1
Sequence:CCGGCCCTACATTAAAGTGACATATCTCGAGATATGTCACTTTAATGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007460
AP3D1 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 3, delta 1 subunit
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201931    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007460.1-1051s1c1
Sequence:CCGGCGAGTGTGTGAACACCGTAATCTCGAGATTACGGTGTTCACACACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191335    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007460.1-4156s1c1
Sequence:CCGGCCACAAATATTCCAACTGGTACTCGAGTACCAGTTGGAATATTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190160    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007460.1-250s1c1
Sequence:CCGGCGACCGCATGTTCGATAAGAACTCGAGTTCTTATCGAACATGCGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007460.1-3570s1c1
Sequence:CCGGCCATCAAAGTCGATGGCATTACTCGAGTAATGCCATCGACTTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007460.1-3671s21c1
Sequence:CCGGTCCATGTACAGCCGCTCTATCCTCGAGGATAGAGCGGCTGTACATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007460.1-2085s21c1
Sequence:CCGGACCTGGATGCCTGGATCAATGCTCGAGCATTGATCCAGGCATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007460.1-1053s21c1
Sequence:CCGGAGTGTGTGAACACCGTAATTGCTCGAGCAATTACGGTGTTCACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240521    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007460.1-4145s21c1
Sequence:CCGGGATGCTGCTGTCCACAAATATCTCGAGATATTTGTGGACAGCAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007460.1-3143s21c1
Sequence:CCGGCCCTACATTAAAGTGACATATCTCGAGATATGTCACTTTAATGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007460
AP3D1 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 3, delta 1 subunit
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201931    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007460.1-1051s1c1
Sequence:CCGGCGAGTGTGTGAACACCGTAATCTCGAGATTACGGTGTTCACACACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191335    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007460.1-4156s1c1
Sequence:CCGGCCACAAATATTCCAACTGGTACTCGAGTACCAGTTGGAATATTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190160    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007460.1-250s1c1
Sequence:CCGGCGACCGCATGTTCGATAAGAACTCGAGTTCTTATCGAACATGCGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007460.1-3570s1c1
Sequence:CCGGCCATCAAAGTCGATGGCATTACTCGAGTAATGCCATCGACTTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007460.1-3671s21c1
Sequence:CCGGTCCATGTACAGCCGCTCTATCCTCGAGGATAGAGCGGCTGTACATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007460.1-2085s21c1
Sequence:CCGGACCTGGATGCCTGGATCAATGCTCGAGCATTGATCCAGGCATCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007460.1-1053s21c1
Sequence:CCGGAGTGTGTGAACACCGTAATTGCTCGAGCAATTACGGTGTTCACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240521    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007460.1-4145s21c1
Sequence:CCGGGATGCTGCTGTCCACAAATATCTCGAGATATTTGTGGACAGCAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007460.1-3143s21c1
Sequence:CCGGCCCTACATTAAAGTGACATATCTCGAGATATGTCACTTTAATGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003938
VALIDATED
AP3D1 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 3, delta 1 subunit
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003938.4-3453s1c1
Sequence:CCGGCGGATGTCCTTCCAGAATCTTCTCGAGAAGATTCTGGAAGGACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003938.4-1436s1c1
Sequence:CCGGCCAGTCCAACTACCAGTACATCTCGAGATGTACTGGTAGTTGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003938.4-404s1c1
Sequence:CCGGGCTGACGTATTTACAGATGTTCTCGAGAACATCTGTAAATACGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003938.4-4715s1c1
Sequence:CCGGCCATGCAGTGATTCCAGGATTCTCGAGAATCCTGGAATCACTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003938.4-252s1c1
Sequence:CCGGGACCGCATGTTCGACAAGAATCTCGAGATTCTTGTCGAACATGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003938.5-2616s21c1
Sequence:GTACCGGCCTACAGGGCTCTGGATATTGCTCGAGCAATATCCAGAGCCCTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286523    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003938.5-4718s21c1
Sequence:CCGGCCATGCAGTGATTCCAGGATTCTCGAGAATCCTGGAATCACTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003938.5-3455s21c1
Sequence:CCGGCGGATGTCCTTCCAGAATCTTCTCGAGAAGATTCTGGAAGGACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003938.5-1438s21c1
Sequence:CCGGCCAGTCCAACTACCAGTACATCTCGAGATGTACTGGTAGTTGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003938.5-483s21c1
Sequence:CCGGAGTTCACCTTCAAGCGAATTGCTCGAGCAATTCGCTTGAAGGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003938.5-398s21c1
Sequence:GTACCGGGTCTGCAAGCTGACGTATTTACTCGAGTAAATACGTCAGCTTGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003938.5-1407s21c1
Sequence:CCGGAGCTGCTCACCAAGATCATTGCTCGAGCAATGATCTTGGTGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003938.5-2376s21c1
Sequence:GTACCGGTGCCTATGTCAGATCAGTATGCTCGAGCATACTGATCTGACATAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003938.5-3820s21c1
Sequence:GTACCGGTGTAGACATCCGAGGTCATTTCTCGAGAAATGACCTCGGATGTCTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003938
VALIDATED
AP3D1 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 3, delta 1 subunit
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003938.4-3453s1c1
Sequence:CCGGCGGATGTCCTTCCAGAATCTTCTCGAGAAGATTCTGGAAGGACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003938.4-1436s1c1
Sequence:CCGGCCAGTCCAACTACCAGTACATCTCGAGATGTACTGGTAGTTGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003938.4-404s1c1
Sequence:CCGGGCTGACGTATTTACAGATGTTCTCGAGAACATCTGTAAATACGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003938.4-4715s1c1
Sequence:CCGGCCATGCAGTGATTCCAGGATTCTCGAGAATCCTGGAATCACTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003938.4-252s1c1
Sequence:CCGGGACCGCATGTTCGACAAGAATCTCGAGATTCTTGTCGAACATGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003938.5-2616s21c1
Sequence:GTACCGGCCTACAGGGCTCTGGATATTGCTCGAGCAATATCCAGAGCCCTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286523    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003938.5-4718s21c1
Sequence:CCGGCCATGCAGTGATTCCAGGATTCTCGAGAATCCTGGAATCACTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003938.5-3455s21c1
Sequence:CCGGCGGATGTCCTTCCAGAATCTTCTCGAGAAGATTCTGGAAGGACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003938.5-1438s21c1
Sequence:CCGGCCAGTCCAACTACCAGTACATCTCGAGATGTACTGGTAGTTGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003938.5-483s21c1
Sequence:CCGGAGTTCACCTTCAAGCGAATTGCTCGAGCAATTCGCTTGAAGGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003938.5-398s21c1
Sequence:GTACCGGGTCTGCAAGCTGACGTATTTACTCGAGTAAATACGTCAGCTTGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003938.5-1407s21c1
Sequence:CCGGAGCTGCTCACCAAGATCATTGCTCGAGCAATGATCTTGGTGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003938.5-2376s21c1
Sequence:GTACCGGTGCCTATGTCAGATCAGTATGCTCGAGCATACTGATCTGACATAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003938.5-3820s21c1
Sequence:GTACCGGTGTAGACATCCGAGGTCATTTCTCGAGAAATGACCTCGGATGTCTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003938
VALIDATED
AP3D1 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 3, delta 1 subunit
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003938.4-3453s1c1
Sequence:CCGGCGGATGTCCTTCCAGAATCTTCTCGAGAAGATTCTGGAAGGACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003938.4-1436s1c1
Sequence:CCGGCCAGTCCAACTACCAGTACATCTCGAGATGTACTGGTAGTTGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003938.4-404s1c1
Sequence:CCGGGCTGACGTATTTACAGATGTTCTCGAGAACATCTGTAAATACGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003938.4-4715s1c1
Sequence:CCGGCCATGCAGTGATTCCAGGATTCTCGAGAATCCTGGAATCACTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003938.4-252s1c1
Sequence:CCGGGACCGCATGTTCGACAAGAATCTCGAGATTCTTGTCGAACATGCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003938.5-2616s21c1
Sequence:GTACCGGCCTACAGGGCTCTGGATATTGCTCGAGCAATATCCAGAGCCCTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286523    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003938.5-4718s21c1
Sequence:CCGGCCATGCAGTGATTCCAGGATTCTCGAGAATCCTGGAATCACTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003938.5-3455s21c1
Sequence:CCGGCGGATGTCCTTCCAGAATCTTCTCGAGAAGATTCTGGAAGGACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003938.5-1438s21c1
Sequence:CCGGCCAGTCCAACTACCAGTACATCTCGAGATGTACTGGTAGTTGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003938.5-483s21c1
Sequence:CCGGAGTTCACCTTCAAGCGAATTGCTCGAGCAATTCGCTTGAAGGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003938.5-398s21c1
Sequence:GTACCGGGTCTGCAAGCTGACGTATTTACTCGAGTAAATACGTCAGCTTGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003938.5-1407s21c1
Sequence:CCGGAGCTGCTCACCAAGATCATTGCTCGAGCAATGATCTTGGTGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003938.5-2376s21c1
Sequence:GTACCGGTGCCTATGTCAGATCAGTATGCTCGAGCATACTGATCTGACATAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003938.5-3820s21c1
Sequence:GTACCGGTGTAGACATCCGAGGTCATTTCTCGAGAAATGACCTCGGATGTCTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks