EMAIL THIS PAGE TO A FRIEND

AP3M1

adaptor-related protein complex 3, mu 1 subunit

175 Gene Product Result for
UniProtKB ID: Q9Y2T2, Q5JQ12, Q9H5L2
Gene ID:
Human(26985) Summary: The protein encoded by this gene is the medium subunit of AP-3, which is an adaptor-related protein complex associated with the Golgi region as well as more peripheral intracellular structures. AP-3 facilitates the budding of vesicles from the Golgi membrane and may be directly involved in protein sorting to the endosomal/lysosomal system. AP-3 is a heterotetrameric protein complex composed of two large subunits (delta and beta3), a medium subunit (mu3), and a small subunit (sigma 3). Mutations in one of the large subunits of AP-3 have been associated with the Hermansky-Pudlak syndrome, a genetic disorder characterized by defective lysosome-related organelles. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008]
Mouse(55946) adaptor-related protein complex 3, mu 1 subunit
Rat(171126) adaptor-related protein complex 3, mu 1 subunit
Zebrafish(266798) adaptor-related protein complex 3, mu 1 subunit
cow(514761) adaptor-related protein complex 3, mu 1 subunit
Horse(100064191) adaptor-related protein complex 3, mu 1 subunit
domestic cat(101089646) adaptor-related protein complex 3, mu 1 subunit
dog(489052) adaptor-related protein complex 3, mu 1 subunit
chicken(423736) adaptor-related protein complex 3, mu 1 subunit
naked mole-rat(101718782) adaptor-related protein complex 3, mu 1 subunit
domestic guinea pig(100722649) adaptor-related protein complex 3, mu 1 subunit
sheep(101122075) adaptor-related protein complex 3, mu 1 subunit
Domestic Rabbit(100356906) adaptor-related protein complex 3, mu 1 subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012095 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012095 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012095 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018829 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018829 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018829 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012095 Rosetta Predictions human pricing
NM_207012 Rosetta Predictions human pricing
NM_133593 Rosetta Predictions rat pricing
NM_018829 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012095 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226970 predicted 1612
2 SASI_Hs01_00226971 predicted 880
3 SASI_Hs01_00226973 predicted 1615
4 SASI_Hs01_00226974 predicted 622
5 SASI_Hs01_00226975 predicted 1235
6 SASI_Hs01_00226976 predicted 1162
7 SASI_Hs01_00226977 predicted 1072
8 SASI_Hs01_00226978 predicted 1289
9 SASI_Hs02_00343597 predicted 1429
10 SASI_Hs02_00343598 predicted 839
11 SASI_Hs01_00226969 predicted 1150
12 SASI_Hs01_00226972 predicted 1611
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207012 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065998 predicted 1740
2 SASI_Hs01_00065999 predicted 1003
3 SASI_Hs01_00066001 predicted 1745
4 SASI_Hs01_00066002 predicted 743
5 SASI_Hs01_00066003 predicted 1356
6 SASI_Hs01_00066004 predicted 1290
7 SASI_Hs01_00066005 predicted 1193
8 SASI_Hs01_00066006 predicted 1409
9 SASI_Hs02_00373703 predicted 1555
10 SASI_Hs02_00373704 predicted 957
11 SASI_Hs01_00065997 predicted 1267
12 SASI_Hs01_00066000 predicted 1743
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133593 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092007 predicted 561
2 SASI_Rn01_00092008 predicted 1080
3 SASI_Rn01_00092011 predicted 1199
4 SASI_Rn01_00092012 predicted 1212
5 SASI_Rn01_00092013 predicted 787
6 SASI_Rn01_00092014 predicted 1135
7 SASI_Rn01_00092015 predicted 633
8 SASI_Rn02_00267795 predicted 948
9 SASI_Rn01_00092016 predicted 587
10 SASI_Rn02_00267796 predicted 771
11 SASI_Rn01_00092009 predicted 1240
12 SASI_Rn01_00092010 predicted 1332
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018829 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324180 predicted 441
2 SASI_Mm01_00187722 predicted 572
3 SASI_Mm01_00187724 predicted 356
4 SASI_Mm02_00324181 predicted 629
5 SASI_Mm02_00324182 predicted 852
6 SASI_Mm02_00324183 predicted 788
7 SASI_Mm02_00324184 predicted 361
8 SASI_Mm01_00187728 predicted 801
9 SASI_Mm01_00187729 predicted 817
10 SASI_Mm01_00187731 predicted 606
11 SASI_Mm01_00187723 predicted 977
12 SASI_Mm01_00187725 predicted 1236
13 SASI_Mm01_00187726 predicted 1159
14 SASI_Mm01_00187727 predicted 1358
15 SASI_Mm01_00187730 predicted 1350
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012095
VALIDATED
AP3M1 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 3, mu 1 subunit
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012095.4-1078s21c1
Sequence:CCGGATGGAAATTTCCGACTCATATCTCGAGATATGAGTCGGAAATTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012095.4-391s21c1
Sequence:CCGGGCCAGTCTGTCTGTGATTATTCTCGAGAATAATCACAGACAGACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012095.4-1316s21c1
Sequence:CCGGTCCAGTCACCAAGGTACTAACCTCGAGGTTAGTACCTTGGTGACTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012095.4-685s21c1
Sequence:CCGGTGGCTACCGAATCTAACATTTCTCGAGAAATGTTAGATTCGGTAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012095.4-627s21c1
Sequence:CCGGGATAATGTGGTCATAGTATATCTCGAGATATACTATGACCACATTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012095.4-1687s21c1
Sequence:CCGGAGCTACACACCGCTAACAAAGCTCGAGCTTTGTTAGCGGTGTGTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012095.3-2877s1c1
Sequence:CCGGGCCTCATTAGACATCAAGAAACTCGAGTTTCTTGATGTCTAATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012095.3-1389s1c1
Sequence:CCGGCCGAGCCTCAACATACAGTTTCTCGAGAAACTGTATGTTGAGGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_012095.3-311s1c1
Sequence:CCGGCGGTGACATATTTCTAGAGAACTCGAGTTCTCTAGAAATATGTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_012095.3-687s1c1
Sequence:CCGGCCAACAATTCTACGCTCTGTTCTCGAGAACAGAGCGTAGAATTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012095.3-1141s1c1
Sequence:CCGGGCGGCAGATTTGATATAACAACTCGAGTTGTTATATCAAATCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012095
VALIDATED
AP3M1 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 3, mu 1 subunit
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012095.4-1078s21c1
Sequence:CCGGATGGAAATTTCCGACTCATATCTCGAGATATGAGTCGGAAATTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012095.4-391s21c1
Sequence:CCGGGCCAGTCTGTCTGTGATTATTCTCGAGAATAATCACAGACAGACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012095.4-1316s21c1
Sequence:CCGGTCCAGTCACCAAGGTACTAACCTCGAGGTTAGTACCTTGGTGACTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012095.4-685s21c1
Sequence:CCGGTGGCTACCGAATCTAACATTTCTCGAGAAATGTTAGATTCGGTAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012095.4-627s21c1
Sequence:CCGGGATAATGTGGTCATAGTATATCTCGAGATATACTATGACCACATTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012095.4-1687s21c1
Sequence:CCGGAGCTACACACCGCTAACAAAGCTCGAGCTTTGTTAGCGGTGTGTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012095.3-2877s1c1
Sequence:CCGGGCCTCATTAGACATCAAGAAACTCGAGTTTCTTGATGTCTAATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012095.3-1389s1c1
Sequence:CCGGCCGAGCCTCAACATACAGTTTCTCGAGAAACTGTATGTTGAGGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_012095.3-311s1c1
Sequence:CCGGCGGTGACATATTTCTAGAGAACTCGAGTTCTCTAGAAATATGTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_012095.3-687s1c1
Sequence:CCGGCCAACAATTCTACGCTCTGTTCTCGAGAACAGAGCGTAGAATTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012095.3-1141s1c1
Sequence:CCGGGCGGCAGATTTGATATAACAACTCGAGTTGTTATATCAAATCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012095
VALIDATED
AP3M1 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 3, mu 1 subunit
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012095.4-1078s21c1
Sequence:CCGGATGGAAATTTCCGACTCATATCTCGAGATATGAGTCGGAAATTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012095.4-391s21c1
Sequence:CCGGGCCAGTCTGTCTGTGATTATTCTCGAGAATAATCACAGACAGACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012095.4-1316s21c1
Sequence:CCGGTCCAGTCACCAAGGTACTAACCTCGAGGTTAGTACCTTGGTGACTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012095.4-685s21c1
Sequence:CCGGTGGCTACCGAATCTAACATTTCTCGAGAAATGTTAGATTCGGTAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012095.4-627s21c1
Sequence:CCGGGATAATGTGGTCATAGTATATCTCGAGATATACTATGACCACATTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012095.4-1687s21c1
Sequence:CCGGAGCTACACACCGCTAACAAAGCTCGAGCTTTGTTAGCGGTGTGTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012095.3-2877s1c1
Sequence:CCGGGCCTCATTAGACATCAAGAAACTCGAGTTTCTTGATGTCTAATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012095.3-1389s1c1
Sequence:CCGGCCGAGCCTCAACATACAGTTTCTCGAGAAACTGTATGTTGAGGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_012095.3-311s1c1
Sequence:CCGGCGGTGACATATTTCTAGAGAACTCGAGTTCTCTAGAAATATGTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_012095.3-687s1c1
Sequence:CCGGCCAACAATTCTACGCTCTGTTCTCGAGAACAGAGCGTAGAATTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012095.3-1141s1c1
Sequence:CCGGGCGGCAGATTTGATATAACAACTCGAGTTGTTATATCAAATCTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018829
VALIDATED
AP3M1 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 3, mu 1 subunit
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000305431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018829.3-465s21c1
Sequence:CCGGTTCTACGTTCTGTCGTCAATTCTCGAGAATTGACGACAGAACGTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018829.3-358s21c1
Sequence:CCGGGGATAATGTGGTCATAGTATACTCGAGTATACTATGACCACATTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018829.3-1215s21c1
Sequence:CCGGTGAACCGCTTGGACATGTATGCTCGAGCATACATGTCCAAGCGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018829.3-1459s21c1
Sequence:CCGGCGGAGCTTTAAGCTAAGGAAACTCGAGTTTCCTTAGCTTAAAGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018829.3-124s21c1
Sequence:CCGGCCAGTCAGTGTGTGACTATTTCTCGAGAAATAGTCACACACTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018829.4-858s21c1
Sequence:CCGGTGAAGAGATAGATGCAATTATCTCGAGATAATTGCATCTATCTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018829.2-127s1c1
Sequence:CCGGCCAGTCAGTGTGTGACTATTTCTCGAGAAATAGTCACACACTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018829.2-1195s1c1
Sequence:CCGGGCTTGCTATTTCAGGCTTAAACTCGAGTTTAAGCCTGAAATAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018829.2-584s1c1
Sequence:CCGGGAAGCCTATCCCGATGTTGTTCTCGAGAACAACATCGGGATAGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018829.2-593s1c1
Sequence:CCGGCCCGATGTTGTTGAAGAGATACTCGAGTATCTCTTCAACAACATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111660    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018829.2-1462s1c1
Sequence:CCGGCGGAGCTTTAAGCTAAGGAAACTCGAGTTTCCTTAGCTTAAAGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018829
VALIDATED
AP3M1 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 3, mu 1 subunit
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000305431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018829.3-465s21c1
Sequence:CCGGTTCTACGTTCTGTCGTCAATTCTCGAGAATTGACGACAGAACGTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018829.3-358s21c1
Sequence:CCGGGGATAATGTGGTCATAGTATACTCGAGTATACTATGACCACATTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018829.3-1215s21c1
Sequence:CCGGTGAACCGCTTGGACATGTATGCTCGAGCATACATGTCCAAGCGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018829.3-1459s21c1
Sequence:CCGGCGGAGCTTTAAGCTAAGGAAACTCGAGTTTCCTTAGCTTAAAGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018829.3-124s21c1
Sequence:CCGGCCAGTCAGTGTGTGACTATTTCTCGAGAAATAGTCACACACTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018829.4-858s21c1
Sequence:CCGGTGAAGAGATAGATGCAATTATCTCGAGATAATTGCATCTATCTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018829.2-127s1c1
Sequence:CCGGCCAGTCAGTGTGTGACTATTTCTCGAGAAATAGTCACACACTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018829.2-1195s1c1
Sequence:CCGGGCTTGCTATTTCAGGCTTAAACTCGAGTTTAAGCCTGAAATAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018829.2-584s1c1
Sequence:CCGGGAAGCCTATCCCGATGTTGTTCTCGAGAACAACATCGGGATAGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018829.2-593s1c1
Sequence:CCGGCCCGATGTTGTTGAAGAGATACTCGAGTATCTCTTCAACAACATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111660    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018829.2-1462s1c1
Sequence:CCGGCGGAGCTTTAAGCTAAGGAAACTCGAGTTTCCTTAGCTTAAAGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018829
VALIDATED
AP3M1 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 3, mu 1 subunit
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000305431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018829.3-465s21c1
Sequence:CCGGTTCTACGTTCTGTCGTCAATTCTCGAGAATTGACGACAGAACGTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018829.3-358s21c1
Sequence:CCGGGGATAATGTGGTCATAGTATACTCGAGTATACTATGACCACATTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018829.3-1215s21c1
Sequence:CCGGTGAACCGCTTGGACATGTATGCTCGAGCATACATGTCCAAGCGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018829.3-1459s21c1
Sequence:CCGGCGGAGCTTTAAGCTAAGGAAACTCGAGTTTCCTTAGCTTAAAGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018829.3-124s21c1
Sequence:CCGGCCAGTCAGTGTGTGACTATTTCTCGAGAAATAGTCACACACTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018829.4-858s21c1
Sequence:CCGGTGAAGAGATAGATGCAATTATCTCGAGATAATTGCATCTATCTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018829.2-127s1c1
Sequence:CCGGCCAGTCAGTGTGTGACTATTTCTCGAGAAATAGTCACACACTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018829.2-1195s1c1
Sequence:CCGGGCTTGCTATTTCAGGCTTAAACTCGAGTTTAAGCCTGAAATAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018829.2-584s1c1
Sequence:CCGGGAAGCCTATCCCGATGTTGTTCTCGAGAACAACATCGGGATAGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018829.2-593s1c1
Sequence:CCGGCCCGATGTTGTTGAAGAGATACTCGAGTATCTCTTCAACAACATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111660    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018829.2-1462s1c1
Sequence:CCGGCGGAGCTTTAAGCTAAGGAAACTCGAGTTTCCTTAGCTTAAAGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks