EMAIL THIS PAGE TO A FRIEND

AP3M2

adaptor-related protein complex 3, mu 2 subunit

63 Gene Product Result for
Synonyms: AP47B CLA20 P47B
UniProtKB ID: P53677, B2RCR0, D3DSY2
Gene ID:
Human(10947) Summary: This gene encodes a subunit of the heterotetrameric adaptor-related protein comlex 3 (AP-3), which belongs to the adaptor complexes medium subunits family. The AP-3 complex plays a role in protein trafficking to lysosomes and specialized organelles. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Aug 2008]
Mouse(64933) adaptor-related protein complex 3, mu 2 subunit
Rat(140667) adaptor-related protein complex 3, mu 2 subunit
naked mole-rat(101712189) adaptor-related protein complex 3, mu 2 subunit
domestic guinea pig(100715489) adaptor-related protein complex 3, mu 2 subunit
sheep(101118077) adaptor-related protein complex 3, mu 2 subunit
Domestic Rabbit(100348941) adaptor-related protein complex 3, mu 2 subunit
Zebrafish(415244) adaptor-related protein complex 3, mu 2 subunit
chicken(426790) adaptor-related protein complex 3, mu 2 subunit
cow(509427) adaptor-related protein complex 3, mu 2 subunit
Horse(100050305) adaptor-related protein complex 3, mu 2 subunit
domestic cat(101100558) adaptor-related protein complex 3, mu 2 subunit
dog(482841) adaptor-related protein complex 3, mu 2 subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029505 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029505 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029505 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006803 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006803 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006803 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006803 Rosetta Predictions human pricing
NM_133305 Rosetta Predictions rat pricing
NM_001122820 Rosetta Predictions mouse pricing
NM_029505 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006803 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150705 predicted 648
2 SASI_Hs01_00150706 predicted 1099
3 SASI_Hs01_00150707 predicted 1081
4 SASI_Hs01_00150709 predicted 870
5 SASI_Hs01_00150710 predicted 883
6 SASI_Hs01_00150711 predicted 944
7 SASI_Hs01_00150712 predicted 700
8 SASI_Hs01_00150713 predicted 781
9 SASI_Hs01_00150714 predicted 885
10 SASI_Hs02_00342323 predicted 862
11 SASI_Hs01_00150708 predicted 255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133305 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041994 predicted 736
2 SASI_Rn01_00041995 predicted 1290
3 SASI_Rn01_00041997 predicted 1320
4 SASI_Rn01_00041998 predicted 1115
5 SASI_Rn02_00267598 predicted 738
6 SASI_Rn01_00041999 predicted 604
7 SASI_Rn02_00267599 predicted 1118
8 SASI_Rn01_00042000 predicted 1309
9 SASI_Rn02_00267600 predicted 600
10 SASI_Rn01_00042001 predicted 1190
11 SASI_Rn01_00041996 predicted 887
12 SASI_Rn01_00042002 predicted 1180
13 SASI_Rn01_00042003 predicted 266
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122820 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309439 predicted 608
2 SASI_Mm02_00309440 predicted 586
3 SASI_Mm02_00309441 predicted 466
4 SASI_Mm02_00309442 predicted 921
5 SASI_Mm02_00309443 predicted 583
6 SASI_Mm02_00309444 predicted 611
7 SASI_Mm02_00309445 predicted 1355
8 SASI_Mm02_00309446 predicted 1414
9 SASI_Mm02_00309447 predicted 1002
10 SASI_Mm02_00309448 predicted 1316
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029505 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086311 predicted 547
2 SASI_Mm01_00086312 predicted 522
3 SASI_Mm02_00335445 predicted 406
4 SASI_Mm01_00086313 predicted 855
5 SASI_Mm01_00086314 predicted 523
6 SASI_Mm01_00086315 predicted 549
7 SASI_Mm01_00086316 predicted 1296
8 SASI_Mm01_00086317 predicted 1357
9 SASI_Mm01_00086318 predicted 942
10 SASI_Mm01_00086320 predicted 1253
11 SASI_Mm01_00086319 predicted 1143
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029505
VALIDATED
AP3M2 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 3, mu 2 subunit
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029505.1-1240s1c1
Sequence:CCGGCCTACGATTAACCTGCAGTTTCTCGAGAAACTGCAGGTTAATCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111615    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029505.1-2651s1c1
Sequence:CCGGCCACCAATAGTCCACAAGTTTCTCGAGAAACTTGTGGACTATTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029505.1-1228s1c1
Sequence:CCGGCCAGATGAGAACCCTACGATTCTCGAGAATCGTAGGGTTCTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029505.1-352s1c1
Sequence:CCGGCCGCCTCTGTTTGTCATTGAACTCGAGTTCAATGACAAACAGAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029505.1-1241s1c1
Sequence:CCGGCTACGATTAACCTGCAGTTTACTCGAGTAAACTGCAGGTTAATCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029505.3-547s21c1
Sequence:GTACCGGTGATAAAGCCTCCCACTATTCCTCGAGGAATAGTGGGAGGCTTTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029505.3-399s21c1
Sequence:CCGGCACCGAGTAGTGGATACATTTCTCGAGAAATGTATCCACTACTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029505.3-671s21c1
Sequence:CCGGTACCAACAACGAGGCCTATTTCTCGAGAAATAGGCCTCGTTGTTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029505.3-1260s21c1
Sequence:CCGGCCTACGATTAACCTGCAGTTTCTCGAGAAACTGCAGGTTAATCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348339    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029505.3-1529s21c1
Sequence:CCGGCTCCGTCTTCAGCCACATAAGCTCGAGCTTATGTGGCTGAAGACGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029505.3-439s21c1
Sequence:CCGGGTTCCGAGCCAGTGATCAAAGCTCGAGCTTTGATCACTGGCTCGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029505.3-761s21c1
Sequence:GTACCGGGGTGATCGATGCCTGTGTTAACTCGAGTTAACACAGGCATCGATCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029505
VALIDATED
AP3M2 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 3, mu 2 subunit
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029505.1-1240s1c1
Sequence:CCGGCCTACGATTAACCTGCAGTTTCTCGAGAAACTGCAGGTTAATCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111615    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029505.1-2651s1c1
Sequence:CCGGCCACCAATAGTCCACAAGTTTCTCGAGAAACTTGTGGACTATTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029505.1-1228s1c1
Sequence:CCGGCCAGATGAGAACCCTACGATTCTCGAGAATCGTAGGGTTCTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029505.1-352s1c1
Sequence:CCGGCCGCCTCTGTTTGTCATTGAACTCGAGTTCAATGACAAACAGAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029505.1-1241s1c1
Sequence:CCGGCTACGATTAACCTGCAGTTTACTCGAGTAAACTGCAGGTTAATCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029505.3-547s21c1
Sequence:GTACCGGTGATAAAGCCTCCCACTATTCCTCGAGGAATAGTGGGAGGCTTTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029505.3-399s21c1
Sequence:CCGGCACCGAGTAGTGGATACATTTCTCGAGAAATGTATCCACTACTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029505.3-671s21c1
Sequence:CCGGTACCAACAACGAGGCCTATTTCTCGAGAAATAGGCCTCGTTGTTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029505.3-1260s21c1
Sequence:CCGGCCTACGATTAACCTGCAGTTTCTCGAGAAACTGCAGGTTAATCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348339    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029505.3-1529s21c1
Sequence:CCGGCTCCGTCTTCAGCCACATAAGCTCGAGCTTATGTGGCTGAAGACGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029505.3-439s21c1
Sequence:CCGGGTTCCGAGCCAGTGATCAAAGCTCGAGCTTTGATCACTGGCTCGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029505.3-761s21c1
Sequence:GTACCGGGGTGATCGATGCCTGTGTTAACTCGAGTTAACACAGGCATCGATCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029505
VALIDATED
AP3M2 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 3, mu 2 subunit
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029505.1-1240s1c1
Sequence:CCGGCCTACGATTAACCTGCAGTTTCTCGAGAAACTGCAGGTTAATCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111615    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029505.1-2651s1c1
Sequence:CCGGCCACCAATAGTCCACAAGTTTCTCGAGAAACTTGTGGACTATTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029505.1-1228s1c1
Sequence:CCGGCCAGATGAGAACCCTACGATTCTCGAGAATCGTAGGGTTCTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029505.1-352s1c1
Sequence:CCGGCCGCCTCTGTTTGTCATTGAACTCGAGTTCAATGACAAACAGAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029505.1-1241s1c1
Sequence:CCGGCTACGATTAACCTGCAGTTTACTCGAGTAAACTGCAGGTTAATCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029505.3-547s21c1
Sequence:GTACCGGTGATAAAGCCTCCCACTATTCCTCGAGGAATAGTGGGAGGCTTTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029505.3-399s21c1
Sequence:CCGGCACCGAGTAGTGGATACATTTCTCGAGAAATGTATCCACTACTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029505.3-671s21c1
Sequence:CCGGTACCAACAACGAGGCCTATTTCTCGAGAAATAGGCCTCGTTGTTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029505.3-1260s21c1
Sequence:CCGGCCTACGATTAACCTGCAGTTTCTCGAGAAACTGCAGGTTAATCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348339    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029505.3-1529s21c1
Sequence:CCGGCTCCGTCTTCAGCCACATAAGCTCGAGCTTATGTGGCTGAAGACGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029505.3-439s21c1
Sequence:CCGGGTTCCGAGCCAGTGATCAAAGCTCGAGCTTTGATCACTGGCTCGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029505.3-761s21c1
Sequence:GTACCGGGGTGATCGATGCCTGTGTTAACTCGAGTTAACACAGGCATCGATCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006803
VALIDATED
AP3M2 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 3, mu 2 subunit
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006803.2-1263s1c1
Sequence:CCGGCGTCTGGATATGTATGGAGAACTCGAGTTCTCCATACATATCCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006803.2-3231s1c1
Sequence:CCGGCCTAAGAAGATATAGAGTGTTCTCGAGAACACTCTATATCTTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006803.2-317s1c1
Sequence:CCGGCCCTCTGTTTGTCATTGAGTTCTCGAGAACTCAATGACAAACAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006803.2-737s1c1
Sequence:CCGGGCCAGACCTTACACTTTCCTTCTCGAGAAGGAAAGTGTAAGGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006803.2-167s1c1
Sequence:CCGGCCGTTCTGTTTGTGATTACTTCTCGAGAAGTAATCACAAACAGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006803.2-1629s21c1
Sequence:CCGGCTATAGGAAAGACCAACATTTCTCGAGAAATGTTGGTCTTTCCTATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006803.2-643s21c1
Sequence:CCGGTTGAAGAGATTGATGCAATTACTCGAGTAATTGCATCAATCTCTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006803.2-464s21c1
Sequence:CCGGTACCGAGTCGAACATTCTTAACTCGAGTTAAGAATGTTCGACTCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006803.2-410s21c1
Sequence:CCGGAGTTGTGGTTTATGAGGTATTCTCGAGAATACCTCATAAACCACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006803.2-342s21c1
Sequence:CCGGCACCGAGTGGTGGACACATTTCTCGAGAAATGTGTCCACCACTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006803.3-744s21c1
Sequence:GTACCGGGGGTGAAATATACCAACAATGCTCGAGCATTGTTGGTATATTTCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006803.3-806s21c1
Sequence:GTACCGGGATAAATCAGGCTCCACAATTCTCGAGAATTGTGGAGCCTGATTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006803.3-522s21c1
Sequence:GTACCGGGTTCAGAGCCAGTGATCAAAGCTCGAGCTTTGATCACTGGCTCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006803
VALIDATED
AP3M2 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 3, mu 2 subunit
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006803.2-1263s1c1
Sequence:CCGGCGTCTGGATATGTATGGAGAACTCGAGTTCTCCATACATATCCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006803.2-3231s1c1
Sequence:CCGGCCTAAGAAGATATAGAGTGTTCTCGAGAACACTCTATATCTTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006803.2-317s1c1
Sequence:CCGGCCCTCTGTTTGTCATTGAGTTCTCGAGAACTCAATGACAAACAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006803.2-737s1c1
Sequence:CCGGGCCAGACCTTACACTTTCCTTCTCGAGAAGGAAAGTGTAAGGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006803.2-167s1c1
Sequence:CCGGCCGTTCTGTTTGTGATTACTTCTCGAGAAGTAATCACAAACAGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006803.2-1629s21c1
Sequence:CCGGCTATAGGAAAGACCAACATTTCTCGAGAAATGTTGGTCTTTCCTATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006803.2-643s21c1
Sequence:CCGGTTGAAGAGATTGATGCAATTACTCGAGTAATTGCATCAATCTCTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006803.2-464s21c1
Sequence:CCGGTACCGAGTCGAACATTCTTAACTCGAGTTAAGAATGTTCGACTCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006803.2-410s21c1
Sequence:CCGGAGTTGTGGTTTATGAGGTATTCTCGAGAATACCTCATAAACCACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006803.2-342s21c1
Sequence:CCGGCACCGAGTGGTGGACACATTTCTCGAGAAATGTGTCCACCACTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006803.3-744s21c1
Sequence:GTACCGGGGGTGAAATATACCAACAATGCTCGAGCATTGTTGGTATATTTCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006803.3-806s21c1
Sequence:GTACCGGGATAAATCAGGCTCCACAATTCTCGAGAATTGTGGAGCCTGATTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006803.3-522s21c1
Sequence:GTACCGGGTTCAGAGCCAGTGATCAAAGCTCGAGCTTTGATCACTGGCTCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006803
VALIDATED
AP3M2 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 3, mu 2 subunit
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006803.2-1263s1c1
Sequence:CCGGCGTCTGGATATGTATGGAGAACTCGAGTTCTCCATACATATCCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006803.2-3231s1c1
Sequence:CCGGCCTAAGAAGATATAGAGTGTTCTCGAGAACACTCTATATCTTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006803.2-317s1c1
Sequence:CCGGCCCTCTGTTTGTCATTGAGTTCTCGAGAACTCAATGACAAACAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006803.2-737s1c1
Sequence:CCGGGCCAGACCTTACACTTTCCTTCTCGAGAAGGAAAGTGTAAGGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006803.2-167s1c1
Sequence:CCGGCCGTTCTGTTTGTGATTACTTCTCGAGAAGTAATCACAAACAGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006803.2-1629s21c1
Sequence:CCGGCTATAGGAAAGACCAACATTTCTCGAGAAATGTTGGTCTTTCCTATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006803.2-643s21c1
Sequence:CCGGTTGAAGAGATTGATGCAATTACTCGAGTAATTGCATCAATCTCTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006803.2-464s21c1
Sequence:CCGGTACCGAGTCGAACATTCTTAACTCGAGTTAAGAATGTTCGACTCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006803.2-410s21c1
Sequence:CCGGAGTTGTGGTTTATGAGGTATTCTCGAGAATACCTCATAAACCACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006803.2-342s21c1
Sequence:CCGGCACCGAGTGGTGGACACATTTCTCGAGAAATGTGTCCACCACTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006803.3-744s21c1
Sequence:GTACCGGGGGTGAAATATACCAACAATGCTCGAGCATTGTTGGTATATTTCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006803.3-806s21c1
Sequence:GTACCGGGATAAATCAGGCTCCACAATTCTCGAGAATTGTGGAGCCTGATTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006803.3-522s21c1
Sequence:GTACCGGGTTCAGAGCCAGTGATCAAAGCTCGAGCTTTGATCACTGGCTCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks