EMAIL THIS PAGE TO A FRIEND

AP3S1

adaptor-related protein complex 3, sigma 1 subunit

106 Gene Product Result for
Synonyms: CLAPS3 Sigma3A
Gene ID:
Mouse(11777) adaptor-related protein complex 3, sigma 1 subunit
Rat(302290) adaptor-related protein complex 3, sigma 1 subunit
naked mole-rat(101720828) adaptor-related protein complex 3, sigma 1 subunit
domestic guinea pig(100719986) adaptor-related protein complex 3, sigma 1 subunit
sheep(101107603) adaptor-related protein complex 3, sigma 1 subunit
Zebrafish(449791) adaptor-related protein complex 3, sigma 1 subunit
chicken(427389) adaptor-related protein complex 3, sigma 1 subunit
cow(780978) AP-3 complex subunit sigma-1-like
cow(536359) adaptor-related protein complex 3, sigma 1 subunit
domestic cat(101101185) adaptor-related protein complex 3, sigma 1 subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108647 Anti-AP3S1 affinity isolated antibody rabbit, mouse, guinea pig, human, bovine, bovine, canine
western blot pricing
A2361 Anti-AP3S1 (241-255) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1405625 Anti-AP3S1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2100129 Anti-AP3S1 antibody produced in rabbit affinity isolated antibody canine, guinea pig, bovine, mouse, rabbit, human, rat
western blot pricing
SAB3500998 Anti-AP3S1 antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009681 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009681 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009681 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001284 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001284 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001284 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002924 Rosetta Predictions human pricing
NM_001284 Rosetta Predictions human pricing
NM_001106933 Rosetta Predictions rat pricing
NM_009681 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002924 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025184 predicted 469
2 SASI_Hs01_00025185 predicted 634
3 SASI_Hs01_00025186 predicted 560
4 SASI_Hs01_00025187 predicted 623
5 SASI_Hs01_00025188 predicted 682
6 SASI_Hs01_00025189 predicted 679
7 SASI_Hs01_00025190 predicted 544
8 SASI_Hs01_00025191 predicted 559
9 SASI_Hs01_00025192 predicted 538
10 SASI_Hs01_00025193 predicted 668
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001284 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331529 predicted 303
2 SASI_Hs02_00331530 predicted 310
3 SASI_Hs01_00129796 predicted 424
4 SASI_Hs01_00129797 predicted 592
5 SASI_Hs01_00129798 predicted 517
6 SASI_Hs01_00129799 predicted 594
7 SASI_Hs01_00129800 predicted 655
8 SASI_Hs01_00129801 predicted 637
9 SASI_Hs01_00129802 predicted 516
10 SASI_Hs01_00129803 predicted 522
11 SASI_Hs01_00129804 predicted 502
12 SASI_Hs01_00129805 predicted 632
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106933 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223836 predicted 633
2 SASI_Rn02_00223837 predicted 632
3 SASI_Rn02_00223838 predicted 539
4 SASI_Rn02_00223839 predicted 409
5 SASI_Rn02_00223840 predicted 236
6 SASI_Rn02_00223841 predicted 678
7 SASI_Rn02_00223842 predicted 203
8 SASI_Rn02_00223843 predicted 204
9 SASI_Rn02_00223844 predicted 432
10 SASI_Rn02_00223845 predicted 594
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009681 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316750 predicted 608
2 SASI_Mm02_00316751 predicted 571
3 SASI_Mm02_00316752 predicted 495
4 SASI_Mm02_00316753 predicted 488
5 SASI_Mm02_00316754 predicted 620
6 SASI_Mm02_00316755 predicted 328
7 SASI_Mm02_00316756 predicted 429
8 SASI_Mm02_00316757 predicted 475
9 SASI_Mm02_00316758 predicted 427
10 SASI_Mm02_00316759 predicted 402
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009681
VALIDATED
AP3S1 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 3, sigma 1 subunit
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009681.4-293s21c1
Sequence:CCGGGACATTATGCAACACTATATTCTCGAGAATATAGTGTTGCATAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009681.4-269s21c1
Sequence:CCGGGCTCTGACAACAAGCTCATTTCTCGAGAAATGAGCTTGTTGTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009681.4-1101s21c1
Sequence:CCGGCCAAGTATGTATTGCATGAAACTCGAGTTTCATGCAATACATACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009681.4-220s21c1
Sequence:CCGGCGCGATGAGAACGTTTGTAATCTCGAGATTACAAACGTTCTCATCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009681.4-429s21c1
Sequence:CCGGCCATGTAGACAAGGTTCATAACTCGAGTTATGAACCTTGTCTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113165    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009681.2-1092s1c1
Sequence:CCGGCCAAGTATGTATTGCATGAAACTCGAGTTTCATGCAATACATACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009681.2-420s1c1
Sequence:CCGGCCATGTAGACAAGGTTCATAACTCGAGTTATGAACCTTGTCTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009681.2-211s1c1
Sequence:CCGGCGCGATGAGAACGTTTGTAATCTCGAGATTACAAACGTTCTCATCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009681.2-260s1c1
Sequence:CCGGGCTCTGACAACAAGCTCATTTCTCGAGAAATGAGCTTGTTGTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009681.2-564s1c1
Sequence:CCGGCCGTGCTGTATCAGCTGTAAACTCGAGTTTACAGCTGATACAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009681
VALIDATED
AP3S1 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 3, sigma 1 subunit
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009681.4-293s21c1
Sequence:CCGGGACATTATGCAACACTATATTCTCGAGAATATAGTGTTGCATAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009681.4-269s21c1
Sequence:CCGGGCTCTGACAACAAGCTCATTTCTCGAGAAATGAGCTTGTTGTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009681.4-1101s21c1
Sequence:CCGGCCAAGTATGTATTGCATGAAACTCGAGTTTCATGCAATACATACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009681.4-220s21c1
Sequence:CCGGCGCGATGAGAACGTTTGTAATCTCGAGATTACAAACGTTCTCATCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009681.4-429s21c1
Sequence:CCGGCCATGTAGACAAGGTTCATAACTCGAGTTATGAACCTTGTCTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113165    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009681.2-1092s1c1
Sequence:CCGGCCAAGTATGTATTGCATGAAACTCGAGTTTCATGCAATACATACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009681.2-420s1c1
Sequence:CCGGCCATGTAGACAAGGTTCATAACTCGAGTTATGAACCTTGTCTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009681.2-211s1c1
Sequence:CCGGCGCGATGAGAACGTTTGTAATCTCGAGATTACAAACGTTCTCATCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009681.2-260s1c1
Sequence:CCGGGCTCTGACAACAAGCTCATTTCTCGAGAAATGAGCTTGTTGTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009681.2-564s1c1
Sequence:CCGGCCGTGCTGTATCAGCTGTAAACTCGAGTTTACAGCTGATACAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009681
VALIDATED
AP3S1 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 3, sigma 1 subunit
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009681.4-293s21c1
Sequence:CCGGGACATTATGCAACACTATATTCTCGAGAATATAGTGTTGCATAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009681.4-269s21c1
Sequence:CCGGGCTCTGACAACAAGCTCATTTCTCGAGAAATGAGCTTGTTGTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009681.4-1101s21c1
Sequence:CCGGCCAAGTATGTATTGCATGAAACTCGAGTTTCATGCAATACATACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009681.4-220s21c1
Sequence:CCGGCGCGATGAGAACGTTTGTAATCTCGAGATTACAAACGTTCTCATCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009681.4-429s21c1
Sequence:CCGGCCATGTAGACAAGGTTCATAACTCGAGTTATGAACCTTGTCTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113165    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009681.2-1092s1c1
Sequence:CCGGCCAAGTATGTATTGCATGAAACTCGAGTTTCATGCAATACATACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009681.2-420s1c1
Sequence:CCGGCCATGTAGACAAGGTTCATAACTCGAGTTATGAACCTTGTCTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009681.2-211s1c1
Sequence:CCGGCGCGATGAGAACGTTTGTAATCTCGAGATTACAAACGTTCTCATCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009681.2-260s1c1
Sequence:CCGGGCTCTGACAACAAGCTCATTTCTCGAGAAATGAGCTTGTTGTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009681.2-564s1c1
Sequence:CCGGCCGTGCTGTATCAGCTGTAAACTCGAGTTTACAGCTGATACAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001284
VALIDATED
AP3S1 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 3, sigma 1 subunit
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001284.2-1055s21c1
Sequence:GTACCGGCACAAGTGCAGCATTCCTTAACTCGAGTTAAGGAATGCTGCACTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001284.2-624s21c1
Sequence:CCGGCTTCCTGAGATCCCAAGAAATCTCGAGATTTCTTGGGATCTCAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001284.2-449s21c1
Sequence:CCGGCCATGTAGACAAGGTTCACAACTCGAGTTGTGAACCTTGTCTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001284.2-302s21c1
Sequence:CCGGACTGATTTATAGACATTATGCCTCGAGGCATAATGTCTATAAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001284.2-387s21c1
Sequence:CCGGCAAGTATTTGTGGAAACATTACTCGAGTAATGTTTCCACAAATACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001284.2-378s21c1
Sequence:CCGGGATCTAATTCAAGTATTTGTGCTCGAGCACAAATACTTGAATTAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001284.2-650s21c1
Sequence:GTACCGGCATTGGTGACATCAGTATAAACTCGAGTTTATACTGATGTCACCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001284.2-219s21c1
Sequence:GTACCGGACTTTCCATTTGGTATCTAAGCTCGAGCTTAGATACCAAATGGAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_001284.1-149s1c1
Sequence:CCGGCCCTACAGTGAAGATACACAACTCGAGTTGTGTATCTTCACTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_001284.1-172s1c1
Sequence:CCGGGCAAATCATCAGGGAGACTTTCTCGAGAAAGTCTCCCTGATGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_001284.1-418s1c1
Sequence:CCGGCCATGTAGACAAGGTTCACAACTCGAGTTGTGAACCTTGTCTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001284.1-225s1c1
Sequence:CCGGGTAATTTCCTAGAAGGAGGATCTCGAGATCCTCCTTCTAGGAAATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001284.1-593s1c1
Sequence:CCGGCTTCCTGAGATCCCAAGAAATCTCGAGATTTCTTGGGATCTCAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001284
VALIDATED
AP3S1 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 3, sigma 1 subunit
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001284.2-1055s21c1
Sequence:GTACCGGCACAAGTGCAGCATTCCTTAACTCGAGTTAAGGAATGCTGCACTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001284.2-624s21c1
Sequence:CCGGCTTCCTGAGATCCCAAGAAATCTCGAGATTTCTTGGGATCTCAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001284.2-449s21c1
Sequence:CCGGCCATGTAGACAAGGTTCACAACTCGAGTTGTGAACCTTGTCTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001284.2-302s21c1
Sequence:CCGGACTGATTTATAGACATTATGCCTCGAGGCATAATGTCTATAAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001284.2-387s21c1
Sequence:CCGGCAAGTATTTGTGGAAACATTACTCGAGTAATGTTTCCACAAATACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001284.2-378s21c1
Sequence:CCGGGATCTAATTCAAGTATTTGTGCTCGAGCACAAATACTTGAATTAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001284.2-650s21c1
Sequence:GTACCGGCATTGGTGACATCAGTATAAACTCGAGTTTATACTGATGTCACCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001284.2-219s21c1
Sequence:GTACCGGACTTTCCATTTGGTATCTAAGCTCGAGCTTAGATACCAAATGGAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_001284.1-149s1c1
Sequence:CCGGCCCTACAGTGAAGATACACAACTCGAGTTGTGTATCTTCACTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_001284.1-172s1c1
Sequence:CCGGGCAAATCATCAGGGAGACTTTCTCGAGAAAGTCTCCCTGATGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_001284.1-418s1c1
Sequence:CCGGCCATGTAGACAAGGTTCACAACTCGAGTTGTGAACCTTGTCTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001284.1-225s1c1
Sequence:CCGGGTAATTTCCTAGAAGGAGGATCTCGAGATCCTCCTTCTAGGAAATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001284.1-593s1c1
Sequence:CCGGCTTCCTGAGATCCCAAGAAATCTCGAGATTTCTTGGGATCTCAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001284
VALIDATED
AP3S1 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 3, sigma 1 subunit
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001284.2-1055s21c1
Sequence:GTACCGGCACAAGTGCAGCATTCCTTAACTCGAGTTAAGGAATGCTGCACTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001284.2-624s21c1
Sequence:CCGGCTTCCTGAGATCCCAAGAAATCTCGAGATTTCTTGGGATCTCAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001284.2-449s21c1
Sequence:CCGGCCATGTAGACAAGGTTCACAACTCGAGTTGTGAACCTTGTCTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001284.2-302s21c1
Sequence:CCGGACTGATTTATAGACATTATGCCTCGAGGCATAATGTCTATAAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001284.2-387s21c1
Sequence:CCGGCAAGTATTTGTGGAAACATTACTCGAGTAATGTTTCCACAAATACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001284.2-378s21c1
Sequence:CCGGGATCTAATTCAAGTATTTGTGCTCGAGCACAAATACTTGAATTAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001284.2-650s21c1
Sequence:GTACCGGCATTGGTGACATCAGTATAAACTCGAGTTTATACTGATGTCACCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001284.2-219s21c1
Sequence:GTACCGGACTTTCCATTTGGTATCTAAGCTCGAGCTTAGATACCAAATGGAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_001284.1-149s1c1
Sequence:CCGGCCCTACAGTGAAGATACACAACTCGAGTTGTGTATCTTCACTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_001284.1-172s1c1
Sequence:CCGGGCAAATCATCAGGGAGACTTTCTCGAGAAAGTCTCCCTGATGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_001284.1-418s1c1
Sequence:CCGGCCATGTAGACAAGGTTCACAACTCGAGTTGTGAACCTTGTCTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001284.1-225s1c1
Sequence:CCGGGTAATTTCCTAGAAGGAGGATCTCGAGATCCTCCTTCTAGGAAATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001284.1-593s1c1
Sequence:CCGGCTTCCTGAGATCCCAAGAAATCTCGAGATTTCTTGGGATCTCAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks