EMAIL THIS PAGE TO A FRIEND

AP3S2

adaptor-related protein complex 3, sigma 2 subunit

61 Gene Product Result for
Synonyms: AP3S3 sigma3b
UniProtKB ID: P59780, B2R677, O09077, O09149, Q53H83, Q99589
Gene ID:
Mouse(11778) adaptor-related protein complex 3, sigma 2 subunit
Rat(683402) adaptor-related protein complex 3, sigma 2 subunit
sheep(101105107) adaptor-related protein complex 3, sigma 2 subunit
Zebrafish(436812) adaptor-related protein complex 3, sigma 2 subunit
cow(508867) adaptor-related protein complex 3, sigma 2 subunit
chicken(415581) adaptor-related protein complex 3, sigma 2 subunit
domestic cat(101082825) adaptor-related protein complex 3, sigma 2 subunit
dog(479042) adaptor-related protein complex 3, sigma 2 subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009682 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009682 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009682 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005829 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005829 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005829 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005829 Rosetta Predictions human pricing
NR_023361 Rosetta Predictions human pricing
NM_001115039 Rosetta Predictions rat pricing
NM_009682 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005829 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082144 predicted 601
2 SASI_Hs01_00082145 predicted 532
3 SASI_Hs01_00082146 predicted 866
4 SASI_Hs01_00082147 predicted 733
5 SASI_Hs01_00082148 predicted 523
6 SASI_Hs01_00082149 predicted 897
7 SASI_Hs01_00082150 predicted 309
8 SASI_Hs01_00082151 predicted 216
9 SASI_Hs01_00082152 predicted 583
10 SASI_Hs01_00082153 predicted 884
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_023361 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00381852 predicted 2335
2 SASI_Hs02_00381853 predicted 1059
3 SASI_Hs02_00381854 predicted 519
4 SASI_Hs02_00381855 predicted 5444
5 SASI_Hs02_00381856 predicted 800
6 SASI_Hs02_00381857 predicted 4952
7 SASI_Hs02_00381858 predicted 1426
8 SASI_Hs02_00381859 predicted 4858
9 SASI_Hs02_00381860 predicted 5043
10 SASI_Hs02_00381861 predicted 5124
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001115039 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252563 predicted 259
2 SASI_Rn02_00252564 predicted 802
3 SASI_Rn02_00252565 predicted 419
4 SASI_Rn02_00252566 predicted 682
5 SASI_Rn02_00252567 predicted 346
6 SASI_Rn02_00252568 predicted 678
7 SASI_Rn02_00252569 predicted 432
8 SASI_Rn02_00252570 predicted 318
9 SASI_Rn02_00252571 predicted 728
10 SASI_Rn02_00252572 predicted 583
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009682 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128228 predicted 292
2 SASI_Mm02_00316760 predicted 214
3 SASI_Mm01_00128230 predicted 760
4 SASI_Mm01_00128233 predicted 437
5 SASI_Mm02_00316761 predicted 343
6 SASI_Mm01_00128234 predicted 959
7 SASI_Mm02_00316762 predicted 671
8 SASI_Mm02_00316763 predicted 300
9 SASI_Mm01_00128235 predicted 798
10 SASI_Mm02_00316764 predicted 920
11 SASI_Mm01_00128229 predicted 649
12 SASI_Mm01_00128231 predicted 408
13 SASI_Mm01_00128232 predicted 905
14 SASI_Mm01_00128236 predicted 417
15 SASI_Mm01_00128237 predicted 398
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009682
VALIDATED
AP3S2 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 3, sigma 2 subunit
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009682.2-357s1c1
Sequence:CCGGCCATATGGATAAGGTGCACTACTCGAGTAGTGCACCTTATCCATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113170    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009682.2-2795s1c1
Sequence:CCGGGCATCTACTTTGTCTGCTATTCTCGAGAATAGCAGACAAAGTAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009682.2-167s1c1
Sequence:CCGGACTTCTTAGAAGGTGGAAGTTCTCGAGAACTTCCACCTTCTAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009682.2-197s1c1
Sequence:CCGGGCTCTGACTACAAACTGATTTCTCGAGAAATCAGTTTGTAGTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009682.2-253s1c1
Sequence:CCGGGTGGATTCATCAGAGAGTGAACTCGAGTTCACTCTCTGATGAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009682.3-263s21c1
Sequence:GTACCGGACTATGCCACCCTCTACTTTGCTCGAGCAAAGTAGAGGGTGGCATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009682.3-599s21c1
Sequence:GTACCGGTCGGTGACCTCAACATCAAAGCTCGAGCTTTGATGTTGAGGTCACCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009682.3-236s21c1
Sequence:CCGGGCTCTGACTACAAACTGATTTCTCGAGAAATCAGTTTGTAGTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009682.3-292s21c1
Sequence:CCGGGTGGATTCATCAGAGAGTGAACTCGAGTTCACTCTCTGATGAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009682.3-396s21c1
Sequence:CCGGCCATATGGATAAGGTGCACTACTCGAGTAGTGCACCTTATCCATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009682.3-206s21c1
Sequence:CCGGACTTCTTAGAAGGTGGAAGTTCTCGAGAACTTCCACCTTCTAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380237    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009682.3-1129s21c1
Sequence:GTACCGGAGAGCAGTTTCCTAGTATATACTCGAGTATATACTAGGAAACTGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009682
VALIDATED
AP3S2 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 3, sigma 2 subunit
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009682.2-357s1c1
Sequence:CCGGCCATATGGATAAGGTGCACTACTCGAGTAGTGCACCTTATCCATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113170    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009682.2-2795s1c1
Sequence:CCGGGCATCTACTTTGTCTGCTATTCTCGAGAATAGCAGACAAAGTAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009682.2-167s1c1
Sequence:CCGGACTTCTTAGAAGGTGGAAGTTCTCGAGAACTTCCACCTTCTAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009682.2-197s1c1
Sequence:CCGGGCTCTGACTACAAACTGATTTCTCGAGAAATCAGTTTGTAGTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009682.2-253s1c1
Sequence:CCGGGTGGATTCATCAGAGAGTGAACTCGAGTTCACTCTCTGATGAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009682.3-263s21c1
Sequence:GTACCGGACTATGCCACCCTCTACTTTGCTCGAGCAAAGTAGAGGGTGGCATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009682.3-599s21c1
Sequence:GTACCGGTCGGTGACCTCAACATCAAAGCTCGAGCTTTGATGTTGAGGTCACCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009682.3-236s21c1
Sequence:CCGGGCTCTGACTACAAACTGATTTCTCGAGAAATCAGTTTGTAGTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009682.3-292s21c1
Sequence:CCGGGTGGATTCATCAGAGAGTGAACTCGAGTTCACTCTCTGATGAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009682.3-396s21c1
Sequence:CCGGCCATATGGATAAGGTGCACTACTCGAGTAGTGCACCTTATCCATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009682.3-206s21c1
Sequence:CCGGACTTCTTAGAAGGTGGAAGTTCTCGAGAACTTCCACCTTCTAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380237    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009682.3-1129s21c1
Sequence:GTACCGGAGAGCAGTTTCCTAGTATATACTCGAGTATATACTAGGAAACTGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009682
VALIDATED
AP3S2 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 3, sigma 2 subunit
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009682.2-357s1c1
Sequence:CCGGCCATATGGATAAGGTGCACTACTCGAGTAGTGCACCTTATCCATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113170    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009682.2-2795s1c1
Sequence:CCGGGCATCTACTTTGTCTGCTATTCTCGAGAATAGCAGACAAAGTAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009682.2-167s1c1
Sequence:CCGGACTTCTTAGAAGGTGGAAGTTCTCGAGAACTTCCACCTTCTAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009682.2-197s1c1
Sequence:CCGGGCTCTGACTACAAACTGATTTCTCGAGAAATCAGTTTGTAGTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009682.2-253s1c1
Sequence:CCGGGTGGATTCATCAGAGAGTGAACTCGAGTTCACTCTCTGATGAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009682.3-263s21c1
Sequence:GTACCGGACTATGCCACCCTCTACTTTGCTCGAGCAAAGTAGAGGGTGGCATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009682.3-599s21c1
Sequence:GTACCGGTCGGTGACCTCAACATCAAAGCTCGAGCTTTGATGTTGAGGTCACCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009682.3-236s21c1
Sequence:CCGGGCTCTGACTACAAACTGATTTCTCGAGAAATCAGTTTGTAGTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009682.3-292s21c1
Sequence:CCGGGTGGATTCATCAGAGAGTGAACTCGAGTTCACTCTCTGATGAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009682.3-396s21c1
Sequence:CCGGCCATATGGATAAGGTGCACTACTCGAGTAGTGCACCTTATCCATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009682.3-206s21c1
Sequence:CCGGACTTCTTAGAAGGTGGAAGTTCTCGAGAACTTCCACCTTCTAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380237    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009682.3-1129s21c1
Sequence:GTACCGGAGAGCAGTTTCCTAGTATATACTCGAGTATATACTAGGAAACTGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005829
VALIDATED
AP3S2 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 3, sigma 2 subunit
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005829.3-544s1c1
Sequence:CCGGCGGAACATCAACATTGGCGATCTCGAGATCGCCAATGTTGATGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005829.3-144s1c1
Sequence:CCGGGCGGGATGACAACATCTGTAACTCGAGTTACAGATGTTGTCATCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005829.3-81s1c1
Sequence:CCGGCCAGCGTTTCCCAGAAGAAATCTCGAGATTTCTTCTGGGAAACGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_005829.3-108s1c1
Sequence:CCGGGCAGATTGTTCGAGAGACTTTCTCGAGAAAGTCTCTCGAACAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005829.3-226s1c1
Sequence:CCGGGCTACCCTCTACTTTGTATTTCTCGAGAAATACAAAGTAGAGGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005829.4-559s21c1
Sequence:CCGGGCGGGATGACAACATCTGTAACTCGAGTTACAGATGTTGTCATCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_005829.4-523s21c1
Sequence:CCGGGCAGATTGTTCGAGAGACTTTCTCGAGAAAGTCTCTCGAACAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005829.4-496s21c1
Sequence:CCGGCCAGCGTTTCCCAGAAGAAATCTCGAGATTTCTTCTGGGAAACGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_005829.4-954s21c1
Sequence:GTACCGGTTCCTCGGAACATCAACATTGCTCGAGCAATGTTGATGTTCCGAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005829.4-641s21c1
Sequence:CCGGGCTACCCTCTACTTTGTATTTCTCGAGAAATACAAAGTAGAGGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005829.4-581s21c1
Sequence:GTACCGGTTCTTGGAGGGTGGAAGTTTGCTCGAGCAAACTTCCACCCTCCAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_005829.4-826s21c1
Sequence:GTACCGGGGAAACAAACATGAATGAAATCTCGAGATTTCATTCATGTTTGTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005829
VALIDATED
AP3S2 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 3, sigma 2 subunit
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005829.3-544s1c1
Sequence:CCGGCGGAACATCAACATTGGCGATCTCGAGATCGCCAATGTTGATGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005829.3-144s1c1
Sequence:CCGGGCGGGATGACAACATCTGTAACTCGAGTTACAGATGTTGTCATCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005829.3-81s1c1
Sequence:CCGGCCAGCGTTTCCCAGAAGAAATCTCGAGATTTCTTCTGGGAAACGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_005829.3-108s1c1
Sequence:CCGGGCAGATTGTTCGAGAGACTTTCTCGAGAAAGTCTCTCGAACAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005829.3-226s1c1
Sequence:CCGGGCTACCCTCTACTTTGTATTTCTCGAGAAATACAAAGTAGAGGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005829.4-559s21c1
Sequence:CCGGGCGGGATGACAACATCTGTAACTCGAGTTACAGATGTTGTCATCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_005829.4-523s21c1
Sequence:CCGGGCAGATTGTTCGAGAGACTTTCTCGAGAAAGTCTCTCGAACAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005829.4-496s21c1
Sequence:CCGGCCAGCGTTTCCCAGAAGAAATCTCGAGATTTCTTCTGGGAAACGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_005829.4-954s21c1
Sequence:GTACCGGTTCCTCGGAACATCAACATTGCTCGAGCAATGTTGATGTTCCGAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005829.4-641s21c1
Sequence:CCGGGCTACCCTCTACTTTGTATTTCTCGAGAAATACAAAGTAGAGGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005829.4-581s21c1
Sequence:GTACCGGTTCTTGGAGGGTGGAAGTTTGCTCGAGCAAACTTCCACCCTCCAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_005829.4-826s21c1
Sequence:GTACCGGGGAAACAAACATGAATGAAATCTCGAGATTTCATTCATGTTTGTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005829
VALIDATED
AP3S2 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 3, sigma 2 subunit
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005829.3-544s1c1
Sequence:CCGGCGGAACATCAACATTGGCGATCTCGAGATCGCCAATGTTGATGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005829.3-144s1c1
Sequence:CCGGGCGGGATGACAACATCTGTAACTCGAGTTACAGATGTTGTCATCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005829.3-81s1c1
Sequence:CCGGCCAGCGTTTCCCAGAAGAAATCTCGAGATTTCTTCTGGGAAACGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_005829.3-108s1c1
Sequence:CCGGGCAGATTGTTCGAGAGACTTTCTCGAGAAAGTCTCTCGAACAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005829.3-226s1c1
Sequence:CCGGGCTACCCTCTACTTTGTATTTCTCGAGAAATACAAAGTAGAGGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005829.4-559s21c1
Sequence:CCGGGCGGGATGACAACATCTGTAACTCGAGTTACAGATGTTGTCATCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_005829.4-523s21c1
Sequence:CCGGGCAGATTGTTCGAGAGACTTTCTCGAGAAAGTCTCTCGAACAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005829.4-496s21c1
Sequence:CCGGCCAGCGTTTCCCAGAAGAAATCTCGAGATTTCTTCTGGGAAACGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_005829.4-954s21c1
Sequence:GTACCGGTTCCTCGGAACATCAACATTGCTCGAGCAATGTTGATGTTCCGAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005829.4-641s21c1
Sequence:CCGGGCTACCCTCTACTTTGTATTTCTCGAGAAATACAAAGTAGAGGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005829.4-581s21c1
Sequence:GTACCGGTTCTTGGAGGGTGGAAGTTTGCTCGAGCAAACTTCCACCCTCCAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_005829.4-826s21c1
Sequence:GTACCGGGGAAACAAACATGAATGAAATCTCGAGATTTCATTCATGTTTGTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks