EMAIL THIS PAGE TO A FRIEND

AP4B1

adaptor-related protein complex 4, beta 1 subunit

111 Gene Product Result for
Synonyms: BETA-4 CPSQ5 SPG47
UniProtKB ID: Q9Y6B7, Q59EJ4, Q96CL6
Gene ID:
Human(10717) Summary: This gene encodes a subunit of a heterotetrameric adapter-like complex 4 that is involved in targeting proteins from the trans-Golgi network to the endosomal-lysosomal system. Mutations in this gene are associated with cerebral palsy spastic quadriplegic type 5 (CPSQ5) disorder. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Mouse(67489) adaptor-related protein complex AP-4, beta 1
Rat(310746) adaptor-related protein complex 4, beta 1 subunit
Zebrafish(393309) adaptor-related protein complex 4, beta 1 subunit
cow(512078) adaptor-related protein complex 4, beta 1 subunit
Horse(100059318) adaptor-related protein complex 4, beta 1 subunit
domestic cat(101100653) adaptor-related protein complex 4, beta 1 subunit
dog(483125) adaptor-related protein complex 4, beta 1 subunit
chicken(419879) adaptor-related protein complex 4, beta 1 subunit
sheep(101120710) adaptor-related protein complex 4, beta 1 subunit
domestic guinea pig(100718272) adaptor-related protein complex 4, beta 1 subunit
naked mole-rat(101714886) adaptor-related protein complex 4, beta 1 subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006594 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006594 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006594 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026193 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026193 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026193 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006594 Rosetta Predictions human pricing
NM_001107709 Rosetta Predictions rat pricing
NM_026193 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006594 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068335 predicted 1065
2 SASI_Hs01_00068336 predicted 1849
3 SASI_Hs01_00068338 predicted 1051
4 SASI_Hs01_00068339 predicted 1176
5 SASI_Hs02_00341898 predicted 969
6 SASI_Hs01_00068342 predicted 1596
7 SASI_Hs02_00341899 predicted 1605
8 SASI_Hs01_00068343 predicted 2074
9 SASI_Hs01_00068344 predicted 341
10 SASI_Hs02_00341900 predicted 1253
11 SASI_Hs01_00068337 predicted 1176
12 SASI_Hs01_00068340 predicted 1584
13 SASI_Hs01_00068341 predicted 596
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107709 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231495 predicted 2134
2 SASI_Rn02_00231496 predicted 2358
3 SASI_Rn02_00231497 predicted 1532
4 SASI_Rn02_00231498 predicted 1318
5 SASI_Rn02_00231499 predicted 487
6 SASI_Rn02_00231500 predicted 1508
7 SASI_Rn02_00231501 predicted 2029
8 SASI_Rn02_00231502 predicted 634
9 SASI_Rn02_00231503 predicted 498
10 SASI_Rn02_00231504 predicted 868
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026193 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060757 predicted 2369
2 SASI_Mm01_00060758 predicted 1453
3 SASI_Mm01_00060759 predicted 1436
4 SASI_Mm01_00060760 predicted 1121
5 SASI_Mm01_00060761 predicted 702
6 SASI_Mm01_00060762 predicted 2277
7 SASI_Mm01_00060763 predicted 2463
8 SASI_Mm01_00060764 predicted 400
9 SASI_Mm01_00060765 predicted 2034
10 SASI_Mm01_00060766 predicted 410
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006594
VALIDATED
AP4B1 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 4, beta 1 subunit
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006594.2-682s21c1
Sequence:CCGGGATGTGCCAAGATGCATAATCCTCGAGGATTATGCATCTTGGCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006594.2-824s21c1
Sequence:CCGGAGGAGGCGTTGTCATCAATAACTCGAGTTATTGATGACAACGCCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006594.2-2398s21c1
Sequence:CCGGCAAGAACGGAGACGCTGAATACTCGAGTATTCAGCGTCTCCGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006594.2-2436s21c1
Sequence:CCGGGAAACTGTGATTGGAACAATTCTCGAGAATTGTTCCAATCACAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006594.2-346s21c1
Sequence:CCGGATGTCATCCAGCGAGTGATTACTCGAGTAATCACTCGCTGGATGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006594.2-963s21c1
Sequence:CCGCCTCAATCTGTTGGATAGTTTCCTCGAGGAAACTATCCAACAGATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006594.2-1155s21c1
Sequence:CCGGCGCCAGATCTTGCATAGTTTACTCGAGTAAACTATGCAAGATCTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006594.1-795s1c1
Sequence:CCGGCCCATTGCTCACCATCTCTTACTCGAGTAAGAGATGGTGAGCAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006594.1-1794s1c1
Sequence:CCGGCGGATTCTGTGTAGCCCTAAACTCGAGTTTAGGGCTACACAGAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006594.1-459s1c1
Sequence:CCGGGCCATCAATACGCTGTGCAAACTCGAGTTTGCACAGCGTATTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006594.1-1685s1c1
Sequence:CCGGGCTAGGACGTTTGTTGTATTACTCGAGTAATACAACAAACGTCCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006594.1-1563s1c1
Sequence:CCGGCCTTATGTGTTAGAGGACTTTCTCGAGAAAGTCCTCTAACACATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006594.1-2075s1c1
Sequence:CCGGCCAGCTTACTGCTGATTATTTCTCGAGAAATAATCAGCAGTAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161837    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006594.1-1511s1c1
Sequence:CCGGGCAAGCACTTATTTGGCTACTCTCGAGAGTAGCCAAATAAGTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006594.1-796s1c1
Sequence:CCGGCCATTGCTCACCATCTCTTAACTCGAGTTAAGAGATGGTGAGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006594.1-320s1c1
Sequence:CCGGCATGACTCAAGGCTTGGACATCTCGAGATGTCCAAGCCTTGAGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006594
VALIDATED
AP4B1 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 4, beta 1 subunit
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006594.2-682s21c1
Sequence:CCGGGATGTGCCAAGATGCATAATCCTCGAGGATTATGCATCTTGGCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006594.2-824s21c1
Sequence:CCGGAGGAGGCGTTGTCATCAATAACTCGAGTTATTGATGACAACGCCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006594.2-2398s21c1
Sequence:CCGGCAAGAACGGAGACGCTGAATACTCGAGTATTCAGCGTCTCCGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006594.2-2436s21c1
Sequence:CCGGGAAACTGTGATTGGAACAATTCTCGAGAATTGTTCCAATCACAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006594.2-346s21c1
Sequence:CCGGATGTCATCCAGCGAGTGATTACTCGAGTAATCACTCGCTGGATGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006594.2-963s21c1
Sequence:CCGCCTCAATCTGTTGGATAGTTTCCTCGAGGAAACTATCCAACAGATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006594.2-1155s21c1
Sequence:CCGGCGCCAGATCTTGCATAGTTTACTCGAGTAAACTATGCAAGATCTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006594.1-795s1c1
Sequence:CCGGCCCATTGCTCACCATCTCTTACTCGAGTAAGAGATGGTGAGCAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006594.1-1794s1c1
Sequence:CCGGCGGATTCTGTGTAGCCCTAAACTCGAGTTTAGGGCTACACAGAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006594.1-459s1c1
Sequence:CCGGGCCATCAATACGCTGTGCAAACTCGAGTTTGCACAGCGTATTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006594.1-1685s1c1
Sequence:CCGGGCTAGGACGTTTGTTGTATTACTCGAGTAATACAACAAACGTCCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006594.1-1563s1c1
Sequence:CCGGCCTTATGTGTTAGAGGACTTTCTCGAGAAAGTCCTCTAACACATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006594.1-2075s1c1
Sequence:CCGGCCAGCTTACTGCTGATTATTTCTCGAGAAATAATCAGCAGTAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161837    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006594.1-1511s1c1
Sequence:CCGGGCAAGCACTTATTTGGCTACTCTCGAGAGTAGCCAAATAAGTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006594.1-796s1c1
Sequence:CCGGCCATTGCTCACCATCTCTTAACTCGAGTTAAGAGATGGTGAGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006594.1-320s1c1
Sequence:CCGGCATGACTCAAGGCTTGGACATCTCGAGATGTCCAAGCCTTGAGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006594
VALIDATED
AP4B1 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 4, beta 1 subunit
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006594.2-682s21c1
Sequence:CCGGGATGTGCCAAGATGCATAATCCTCGAGGATTATGCATCTTGGCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006594.2-824s21c1
Sequence:CCGGAGGAGGCGTTGTCATCAATAACTCGAGTTATTGATGACAACGCCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006594.2-2398s21c1
Sequence:CCGGCAAGAACGGAGACGCTGAATACTCGAGTATTCAGCGTCTCCGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006594.2-2436s21c1
Sequence:CCGGGAAACTGTGATTGGAACAATTCTCGAGAATTGTTCCAATCACAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006594.2-346s21c1
Sequence:CCGGATGTCATCCAGCGAGTGATTACTCGAGTAATCACTCGCTGGATGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006594.2-963s21c1
Sequence:CCGCCTCAATCTGTTGGATAGTTTCCTCGAGGAAACTATCCAACAGATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006594.2-1155s21c1
Sequence:CCGGCGCCAGATCTTGCATAGTTTACTCGAGTAAACTATGCAAGATCTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006594.1-795s1c1
Sequence:CCGGCCCATTGCTCACCATCTCTTACTCGAGTAAGAGATGGTGAGCAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006594.1-1794s1c1
Sequence:CCGGCGGATTCTGTGTAGCCCTAAACTCGAGTTTAGGGCTACACAGAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006594.1-459s1c1
Sequence:CCGGGCCATCAATACGCTGTGCAAACTCGAGTTTGCACAGCGTATTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006594.1-1685s1c1
Sequence:CCGGGCTAGGACGTTTGTTGTATTACTCGAGTAATACAACAAACGTCCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006594.1-1563s1c1
Sequence:CCGGCCTTATGTGTTAGAGGACTTTCTCGAGAAAGTCCTCTAACACATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006594.1-2075s1c1
Sequence:CCGGCCAGCTTACTGCTGATTATTTCTCGAGAAATAATCAGCAGTAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161837    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006594.1-1511s1c1
Sequence:CCGGGCAAGCACTTATTTGGCTACTCTCGAGAGTAGCCAAATAAGTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006594.1-796s1c1
Sequence:CCGGCCATTGCTCACCATCTCTTAACTCGAGTTAAGAGATGGTGAGCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006594.1-320s1c1
Sequence:CCGGCATGACTCAAGGCTTGGACATCTCGAGATGTCCAAGCCTTGAGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026193
VALIDATED
AP4B1 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 4, beta 1 subunit
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000287272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026193.1-2111s21c2
Sequence:CCGGGCACTTGATTTCCGAGGAGAACTCGAGTTCTCCTCGGAAATCAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026193.1-1441s21c1
Sequence:CCGGCCAAGACTTACACAGATCAATCTCGAGATTGATCTGTGTAAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026193.1-693s21c1
Sequence:CCGGGTTAACGGTCTGCGTGATAAACTCGAGTTTATCACGCAGACCGTTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026193.1-409s21c1
Sequence:CCGGATGTCATCCAGCGAGTTATTACTCGAGTAATAACTCGCTGGATGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100845    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026193.1-2560s1c1
Sequence:CCGGGCTGCTTGTAAGTCCACATATCTCGAGATATGTGGACTTACAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026193.1-1440s1c1
Sequence:CCGGGCCAAGACTTACACAGATCAACTCGAGTTGATCTGTGTAAGTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026193.1-363s1c1
Sequence:CCGGGCTCTGTGTAACCCTCATATTCTCGAGAATATGAGGGTTACACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026193.1-2111s1c1
Sequence:CCGGGCACTTGATTTCCGAGGAGAACTCGAGTTCTCCTCGGAAATCAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026193.1-1441s1c1
Sequence:CCGGCCAAGACTTACACAGATCAATCTCGAGATTGATCTGTGTAAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026193
VALIDATED
AP4B1 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 4, beta 1 subunit
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000287272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026193.1-2111s21c2
Sequence:CCGGGCACTTGATTTCCGAGGAGAACTCGAGTTCTCCTCGGAAATCAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026193.1-1441s21c1
Sequence:CCGGCCAAGACTTACACAGATCAATCTCGAGATTGATCTGTGTAAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026193.1-693s21c1
Sequence:CCGGGTTAACGGTCTGCGTGATAAACTCGAGTTTATCACGCAGACCGTTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026193.1-409s21c1
Sequence:CCGGATGTCATCCAGCGAGTTATTACTCGAGTAATAACTCGCTGGATGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100845    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026193.1-2560s1c1
Sequence:CCGGGCTGCTTGTAAGTCCACATATCTCGAGATATGTGGACTTACAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026193.1-1440s1c1
Sequence:CCGGGCCAAGACTTACACAGATCAACTCGAGTTGATCTGTGTAAGTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026193.1-363s1c1
Sequence:CCGGGCTCTGTGTAACCCTCATATTCTCGAGAATATGAGGGTTACACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026193.1-2111s1c1
Sequence:CCGGGCACTTGATTTCCGAGGAGAACTCGAGTTCTCCTCGGAAATCAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026193.1-1441s1c1
Sequence:CCGGCCAAGACTTACACAGATCAATCTCGAGATTGATCTGTGTAAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026193
VALIDATED
AP4B1 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 4, beta 1 subunit
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000287272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026193.1-2111s21c2
Sequence:CCGGGCACTTGATTTCCGAGGAGAACTCGAGTTCTCCTCGGAAATCAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026193.1-1441s21c1
Sequence:CCGGCCAAGACTTACACAGATCAATCTCGAGATTGATCTGTGTAAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026193.1-693s21c1
Sequence:CCGGGTTAACGGTCTGCGTGATAAACTCGAGTTTATCACGCAGACCGTTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026193.1-409s21c1
Sequence:CCGGATGTCATCCAGCGAGTTATTACTCGAGTAATAACTCGCTGGATGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100845    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026193.1-2560s1c1
Sequence:CCGGGCTGCTTGTAAGTCCACATATCTCGAGATATGTGGACTTACAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026193.1-1440s1c1
Sequence:CCGGGCCAAGACTTACACAGATCAACTCGAGTTGATCTGTGTAAGTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026193.1-363s1c1
Sequence:CCGGGCTCTGTGTAACCCTCATATTCTCGAGAATATGAGGGTTACACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026193.1-2111s1c1
Sequence:CCGGGCACTTGATTTCCGAGGAGAACTCGAGTTCTCCTCGGAAATCAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026193.1-1441s1c1
Sequence:CCGGCCAAGACTTACACAGATCAATCTCGAGATTGATCTGTGTAAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks