EMAIL THIS PAGE TO A FRIEND

AP4E1

adaptor-related protein complex 4, epsilon 1 subunit

214 Gene Product Result for
Synonyms: CPSQ4 SPG51
Gene ID:
Human(23431) Summary: This gene encodes a member of the adaptor complexes large subunit protein family. These proteins are components of the heterotetrameric adaptor protein complexes, which play important roles in the secretory and endocytic pathways by mediating vesicle formation and sorting of integral membrane proteins. The encoded protein is a large subunit of adaptor protein complex-4, which is associated with both clathrin- and nonclathrin-coated vesicles. Disruption of this gene may be associated with cerebral palsy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
Mouse(108011) adaptor-related protein complex AP-4, epsilon 1
Rat(311404) adaptor-related protein complex 4, epsilon 1 subunit
Zebrafish(570467) adaptor-related protein complex 4, epsilon 1 subunit
chicken(415425) adaptor-related protein complex 4, epsilon 1 subunit
domestic cat(101083086) adaptor-related protein complex 4, epsilon 1 subunit
cow(536144) adaptor-related protein complex 4, epsilon 1 subunit
cow(613640) adaptor-related protein complex 4, epsilon 1 subunit
dog(478304) adaptor-related protein complex 4, epsilon 1 subunit
naked mole-rat(101708335) adaptor-related protein complex 4, epsilon 1 subunit
domestic guinea pig(100720797) adaptor-related protein complex 4, epsilon 1 subunit
sheep(101106174) adaptor-related protein complex 4, epsilon 1 subunit
Domestic Rabbit(100347677) adaptor-related protein complex 4, epsilon 1 subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007347 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007347 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007347 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175550 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175550 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175550 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU212861 MISSION® esiRNA esiRNA targeting mouse Ap4e1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007347 Rosetta Predictions human pricing
XM_001078375 Rosetta Predictions rat pricing
XM_230571 Rosetta Predictions rat pricing
NM_175550 Rosetta Predictions mouse pricing
XM_894489 Rosetta Predictions mouse pricing
XM_901599 Rosetta Predictions mouse pricing
XM_901601 Rosetta Predictions mouse pricing
XM_901604 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007347 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343436 predicted 920
2 SASI_Hs01_00065070 predicted 2492
3 SASI_Hs01_00065071 predicted 272
4 SASI_Hs01_00065072 predicted 2950
5 SASI_Hs01_00065073 predicted 2643
6 SASI_Hs01_00065074 predicted 795
7 SASI_Hs02_00343437 predicted 1622
8 SASI_Hs02_00343438 predicted 731
9 SASI_Hs01_00065075 predicted 1304
10 SASI_Hs01_00065077 predicted 2507
11 SASI_Hs01_00065076 predicted 272
12 SASI_Hs01_00065078 predicted 3053
13 SASI_Hs01_00065079 predicted 2225
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078375 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00360574 predicted 967
2 SASI_Rn02_00360575 predicted 894
3 SASI_Rn02_00360576 predicted 1520
4 SASI_Rn02_00360577 predicted 1113
5 SASI_Rn02_00360578 predicted 945
6 SASI_Rn02_00360579 predicted 3117
7 SASI_Rn02_00360580 predicted 3082
8 SASI_Rn02_00360581 predicted 643
9 SASI_Rn02_00360582 predicted 1678
10 SASI_Rn02_00360583 predicted 957
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_230571 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386359 predicted 1516
2 SASI_Rn02_00386360 predicted 1361
3 SASI_Rn02_00386361 predicted 1107
4 SASI_Rn02_00386362 predicted 2400
5 SASI_Rn02_00386363 predicted 1240
6 SASI_Rn02_00386364 predicted 3112
7 SASI_Rn02_00386365 predicted 2855
8 SASI_Rn02_00386366 predicted 1438
9 SASI_Rn02_00386367 predicted 3086
10 SASI_Rn02_00386368 predicted 1682
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175550 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346505 predicted 896
2 SASI_Mm02_00346506 predicted 1880
3 SASI_Mm02_00346507 predicted 961
4 SASI_Mm02_00346508 predicted 3234
5 SASI_Mm02_00346509 predicted 719
6 SASI_Mm02_00346510 predicted 1653
7 SASI_Mm02_00346511 predicted 944
8 SASI_Mm02_00346512 predicted 1646
9 SASI_Mm02_00346513 predicted 1629
10 SASI_Mm02_00346514 predicted 1301
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_894489 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00259072 predicted 897
2 SASI_Mm01_00259073 predicted 1881
3 SASI_Mm01_00259074 predicted 2859
4 SASI_Mm01_00259075 predicted 970
5 SASI_Mm01_00259076 predicted 3234
6 SASI_Mm01_00259077 predicted 722
7 SASI_Mm01_00259078 predicted 1665
8 SASI_Mm01_00259079 predicted 943
9 SASI_Mm01_00259080 predicted 1654
10 SASI_Mm01_00259081 predicted 1636
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901599 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00265113 predicted 958
2 SASI_Mm01_00265114 predicted 348
3 SASI_Mm01_00265115 predicted 716
4 SASI_Mm01_00265116 predicted 972
5 SASI_Mm01_00265117 predicted 379
6 SASI_Mm01_00265118 predicted 887
7 SASI_Mm01_00265119 predicted 706
8 SASI_Mm01_00265120 predicted 270
9 SASI_Mm01_00265121 predicted 473
10 SASI_Mm01_00265122 predicted 333
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901601 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00268303 predicted 738
2 SASI_Mm01_00268304 predicted 859
3 SASI_Mm01_00268305 predicted 704
4 SASI_Mm01_00268306 predicted 704
5 SASI_Mm01_00268307 predicted 872
6 SASI_Mm01_00268308 predicted 750
7 SASI_Mm01_00268309 predicted 192
8 SASI_Mm01_00268310 predicted 269
9 SASI_Mm01_00268311 predicted 302
10 SASI_Mm01_00268312 predicted 351
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901604 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00221660 predicted 529
2 SASI_Mm01_00221661 predicted 460
3 SASI_Mm01_00221662 predicted 415
4 SASI_Mm01_00221663 predicted 791
5 SASI_Mm01_00221664 predicted 269
6 SASI_Mm01_00221665 predicted 313
7 SASI_Mm01_00221666 predicted 950
8 SASI_Mm01_00221667 predicted 293
9 SASI_Mm01_00221668 predicted 248
10 SASI_Mm01_00221669 predicted 281
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007347
VALIDATED
AP4E1 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 4, epsilon 1 subunit
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007347.2-1339s1c1
Sequence:CCGGGCTGAGAAATATGCTCCTGATCTCGAGATCAGGAGCATATTTCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007347.2-935s1c1
Sequence:CCGGCCTTACGAAGAGCTGAGTTAACTCGAGTTAACTCAGCTCTTCGTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_007347.2-1633s1c1
Sequence:CCGGGCTAAGCTCTACAAGTTACTTCTCGAGAAGTAACTTGTAGAGCTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007347.2-3386s1c1
Sequence:CCGGGTTCTACTCTTCCTGACTATTCTCGAGAATAGTCAGGAAGAGTAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007347.2-457s1c1
Sequence:CCGGCAGAGCACTAACCTAGTAGAACTCGAGTTCTACTAGGTTAGTGCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148614    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_007347.2-3616s1c1
Sequence:CCGGCCCTAACCTTTAACTCAGGATCTCGAGATCCTGAGTTAAAGGTTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_007347.3-3252s21c1
Sequence:GTACCGGGAAACTAAGACTCCATATTATCTCGAGATAATATGGAGTCTTAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_007347.3-2251s21c1
Sequence:GTACCGGGTAGATCAAGCTATAACTAAACTCGAGTTTAGTTATAGCTTGATCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_007347.3-1296s21c1
Sequence:CCGGAGAGTATGTCATCGTCAATTTCTCGAGAAATTGACGATGACATACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007347.3-3616s21c1
Sequence:CCGGCCCTAACCTTTAACTCAGGATCTCGAGATCCTGAGTTAAAGGTTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007347.3-457s21c1
Sequence:CCGGCAGAGCACTAACCTAGTAGAACTCGAGTTCTACTAGGTTAGTGCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_007347.3-3388s21c1
Sequence:CCGGTCTACTCTTCCTGACTATTTACTCGAGTAAATAGTCAGGAAGAGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007347.3-1633s21c1
Sequence:CCGGGCTAAGCTCTACAAGTTACTTCTCGAGAAGTAACTTGTAGAGCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_007347.3-307s21c1
Sequence:GTACCGGGATGCTTCCTTTGGCTATATTCTCGAGAATATAGCCAAAGGAAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007347
VALIDATED
AP4E1 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 4, epsilon 1 subunit
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007347.2-1339s1c1
Sequence:CCGGGCTGAGAAATATGCTCCTGATCTCGAGATCAGGAGCATATTTCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007347.2-935s1c1
Sequence:CCGGCCTTACGAAGAGCTGAGTTAACTCGAGTTAACTCAGCTCTTCGTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_007347.2-1633s1c1
Sequence:CCGGGCTAAGCTCTACAAGTTACTTCTCGAGAAGTAACTTGTAGAGCTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007347.2-3386s1c1
Sequence:CCGGGTTCTACTCTTCCTGACTATTCTCGAGAATAGTCAGGAAGAGTAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007347.2-457s1c1
Sequence:CCGGCAGAGCACTAACCTAGTAGAACTCGAGTTCTACTAGGTTAGTGCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148614    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_007347.2-3616s1c1
Sequence:CCGGCCCTAACCTTTAACTCAGGATCTCGAGATCCTGAGTTAAAGGTTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_007347.3-3252s21c1
Sequence:GTACCGGGAAACTAAGACTCCATATTATCTCGAGATAATATGGAGTCTTAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_007347.3-2251s21c1
Sequence:GTACCGGGTAGATCAAGCTATAACTAAACTCGAGTTTAGTTATAGCTTGATCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_007347.3-1296s21c1
Sequence:CCGGAGAGTATGTCATCGTCAATTTCTCGAGAAATTGACGATGACATACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007347.3-3616s21c1
Sequence:CCGGCCCTAACCTTTAACTCAGGATCTCGAGATCCTGAGTTAAAGGTTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007347.3-457s21c1
Sequence:CCGGCAGAGCACTAACCTAGTAGAACTCGAGTTCTACTAGGTTAGTGCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_007347.3-3388s21c1
Sequence:CCGGTCTACTCTTCCTGACTATTTACTCGAGTAAATAGTCAGGAAGAGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007347.3-1633s21c1
Sequence:CCGGGCTAAGCTCTACAAGTTACTTCTCGAGAAGTAACTTGTAGAGCTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_007347.3-307s21c1
Sequence:GTACCGGGATGCTTCCTTTGGCTATATTCTCGAGAATATAGCCAAAGGAAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007347
VALIDATED
AP4E1 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 4, epsilon 1 subunit
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007347.2-1339s1c1
Sequence:CCGGGCTGAGAAATATGCTCCTGATCTCGAGATCAGGAGCATATTTCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007347.2-935s1c1
Sequence:CCGGCCTTACGAAGAGCTGAGTTAACTCGAGTTAACTCAGCTCTTCGTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_007347.2-1633s1c1
Sequence:CCGGGCTAAGCTCTACAAGTTACTTCTCGAGAAGTAACTTGTAGAGCTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007347.2-3386s1c1
Sequence:CCGGGTTCTACTCTTCCTGACTATTCTCGAGAATAGTCAGGAAGAGTAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007347.2-457s1c1
Sequence:CCGGCAGAGCACTAACCTAGTAGAACTCGAGTTCTACTAGGTTAGTGCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148614    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_007347.2-3616s1c1
Sequence:CCGGCCCTAACCTTTAACTCAGGATCTCGAGATCCTGAGTTAAAGGTTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_007347.3-3252s21c1
Sequence:GTACCGGGAAACTAAGACTCCATATTATCTCGAGATAATATGGAGTCTTAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_007347.3-2251s21c1
Sequence:GTACCGGGTAGATCAAGCTATAACTAAACTCGAGTTTAGTTATAGCTTGATCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_007347.3-1296s21c1
Sequence:CCGGAGAGTATGTCATCGTCAATTTCTCGAGAAATTGACGATGACATACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007347.3-3616s21c1
Sequence:CCGGCCCTAACCTTTAACTCAGGATCTCGAGATCCTGAGTTAAAGGTTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007347.3-457s21c1
Sequence:CCGGCAGAGCACTAACCTAGTAGAACTCGAGTTCTACTAGGTTAGTGCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_007347.3-3388s21c1
Sequence:CCGGTCTACTCTTCCTGACTATTTACTCGAGTAAATAGTCAGGAAGAGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007347.3-1633s21c1
Sequence:CCGGGCTAAGCTCTACAAGTTACTTCTCGAGAAGTAACTTGTAGAGCTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_007347.3-307s21c1
Sequence:GTACCGGGATGCTTCCTTTGGCTATATTCTCGAGAATATAGCCAAAGGAAGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175550
VALIDATED
AP4E1 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 4, epsilon 1 subunit
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175550.3-1886s21c1
Sequence:CCGGATAGTGGCAGATGCGTCTTTACTCGAGTAAAGACGCATCTGCCACTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175550.3-540s21c1
Sequence:CCGGCAGCCGTTCTTCCACTAATAGCTCGAGCTATTAGTGGAAGAACGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175550.3-3062s21c1
Sequence:CCGGTCCATGAACTTACCATTATTACTCGAGTAATAATGGTAAGTTCATGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175550.3-3623s21c1
Sequence:CCGGACATGACCTAAGCTAATATTACTCGAGTAATATTAGCTTAGGTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175550.3-946s21c1
Sequence:CCGGCTTACGAAGAGCCGAGTTAAACTCGAGTTTAACTCGGCTCTTCGTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175550
VALIDATED
AP4E1 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 4, epsilon 1 subunit
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175550.3-1886s21c1
Sequence:CCGGATAGTGGCAGATGCGTCTTTACTCGAGTAAAGACGCATCTGCCACTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175550.3-540s21c1
Sequence:CCGGCAGCCGTTCTTCCACTAATAGCTCGAGCTATTAGTGGAAGAACGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175550.3-3062s21c1
Sequence:CCGGTCCATGAACTTACCATTATTACTCGAGTAATAATGGTAAGTTCATGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175550.3-3623s21c1
Sequence:CCGGACATGACCTAAGCTAATATTACTCGAGTAATATTAGCTTAGGTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175550.3-946s21c1
Sequence:CCGGCTTACGAAGAGCCGAGTTAAACTCGAGTTTAACTCGGCTCTTCGTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175550
VALIDATED
AP4E1 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 4, epsilon 1 subunit
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175550.3-1886s21c1
Sequence:CCGGATAGTGGCAGATGCGTCTTTACTCGAGTAAAGACGCATCTGCCACTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175550.3-540s21c1
Sequence:CCGGCAGCCGTTCTTCCACTAATAGCTCGAGCTATTAGTGGAAGAACGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175550.3-3062s21c1
Sequence:CCGGTCCATGAACTTACCATTATTACTCGAGTAATAATGGTAAGTTCATGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175550.3-3623s21c1
Sequence:CCGGACATGACCTAAGCTAATATTACTCGAGTAATATTAGCTTAGGTCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175550.3-946s21c1
Sequence:CCGGCTTACGAAGAGCCGAGTTAAACTCGAGTTTAACTCGGCTCTTCGTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)