EMAIL THIS PAGE TO A FRIEND

AP4M1

adaptor-related protein complex 4, mu 1 subunit

48 Gene Product Result for
Synonyms: CPSQ3 MU-4 MU-ARP2 SPG50
UniProtKB ID: O00189, D6W5U1, Q8WV65, Q9UHK9
Gene ID:
Human(9179) Summary: This gene encodes a subunit of the heterotetrameric AP-4 complex. The encoded protein belongs to the adaptor complexes medium subunits family. This AP-4 complex is involved in the recognition and sorting of cargo proteins with tyrosine-based motifs from the trans-golgi network to the endosomal-lysosomal system. [provided by RefSeq, Jul 2008]
Mouse(11781) adaptor-related protein complex AP-4, mu 1
Rat(304344) adaptor-related protein complex 4, mu 1 subunit
Goat(100861048) adaptor-related protein complex 4, mu 1 subunit
sheep(101107757) adaptor-related protein complex 4, mu 1 subunit
Domestic Rabbit(100343610) adaptor-related protein complex 4, mu 1 subunit
domestic guinea pig(100718951) adaptor-related protein complex 4, mu 1 subunit
naked mole-rat(101725856) adaptor-related protein complex 4, mu 1 subunit
Zebrafish(436945) adaptor-related protein complex 4, mu 1 subunit
chicken(396046) adaptor-related protein complex 4, mu 1 subunit
cow(768040) adaptor-related protein complex 4, mu 1 subunit
Horse(100068686) adaptor-related protein complex 4, mu 1 subunit
domestic cat(101088638) adaptor-related protein complex 4, mu 1 subunit
dog(489847) adaptor-related protein complex 4, mu 1 subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021392 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021392 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021392 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004722 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004722 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004722 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU045241 MISSION® esiRNA esiRNA targeting mouse Ap4m1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004722 Rosetta Predictions human pricing
NM_001037977 Rosetta Predictions rat pricing
NM_021392 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004722 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066037 predicted 517
2 SASI_Hs01_00066038 predicted 394
3 SASI_Hs01_00066039 predicted 1600
4 SASI_Hs01_00066040 predicted 973
5 SASI_Hs01_00066041 predicted 779
6 SASI_Hs01_00066042 predicted 286
7 SASI_Hs01_00066043 predicted 1511
8 SASI_Hs01_00066045 predicted 880
9 SASI_Hs01_00066046 predicted 1302
10 SASI_Hs02_00338196 predicted 1542
11 SASI_Hs01_00066044 predicted 320
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037977 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118116 predicted 691
2 SASI_Rn01_00118117 predicted 670
3 SASI_Rn01_00118118 predicted 739
4 SASI_Rn01_00118119 predicted 719
5 SASI_Rn01_00118120 predicted 843
6 SASI_Rn01_00118121 predicted 1098
7 SASI_Rn01_00118122 predicted 777
8 SASI_Rn01_00118124 predicted 303
9 SASI_Rn01_00118125 predicted 390
10 SASI_Rn02_00204655 predicted 357
11 SASI_Rn01_00118123 predicted 771
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021392 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161232 predicted 560
2 SASI_Mm01_00161233 predicted 1014
3 SASI_Mm01_00161234 predicted 312
4 SASI_Mm01_00161235 predicted 752
5 SASI_Mm01_00161236 predicted 535
6 SASI_Mm02_00325993 predicted 949
7 SASI_Mm01_00161237 predicted 762
8 SASI_Mm01_00161238 predicted 1282
9 SASI_Mm01_00161239 predicted 478
10 SASI_Mm01_00161241 predicted 939
11 SASI_Mm01_00161240 predicted 1063
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021392
VALIDATED
AP4M1 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 4, mu 1 subunit
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382493    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021392.4-1547s21c1
Sequence:GTACCGGCAATGTGAGCAGGCAGTTGAACTCGAGTTCAACTGCCTGCTCACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021392.4-1531s21c1
Sequence:GTACCGGGCAAGGATATGGACAGCAATGCTCGAGCATTGCTGTCCATATCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021392.4-1498s21c1
Sequence:CCGGACGCCTACGTAATTCGGATTTCTCGAGAAATCCGAATTACGTAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021392.4-1563s21c1
Sequence:CCGGTTGAACAGGAAGAGGACATTTCTCGAGAAATGTCCTCTTCCTGTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021392.4-347s21c1
Sequence:CCGGCAGACACAGTGGGCTCTATTTCTCGAGAAATAGAGCCCACTGTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021392.4-850s21c1
Sequence:CCGGGCATTGGCTTGACAGAAGAATCTCGAGATTCTTCTGTCAAGCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021392.4-309s21c1
Sequence:CCGGGTTGTCATGTATCACGGTGATCTCGAGATCACCGTGATACATGACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021392.4-756s21c1
Sequence:GTACCGGTCTGTACTGATTGCATCTAATCTCGAGATTAGATGCAATCAGTACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021392.4-883s21c1
Sequence:GTACCGGAGTCAGAACTGAGAGGTTATGCTCGAGCATAACCTCTCAGTTCTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111695    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021392.2-1533s1c1
Sequence:CCGGAGCAAGGATATGGACAGCAATCTCGAGATTGCTGTCCATATCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021392.2-312s1c1
Sequence:CCGGGTTGTCATGTATCACGGTGATCTCGAGATCACCGTGATACATGACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021392.2-853s1c1
Sequence:CCGGGCATTGGCTTGACAGAAGAATCTCGAGATTCTTCTGTCAAGCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021392.2-642s1c1
Sequence:CCGGGCAGAGACACAGCAGAATAAACTCGAGTTTATTCTGCTGTGTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021392.2-495s1c1
Sequence:CCGGCTTGTCTACGAACTCCTGGATCTCGAGATCCAGGAGTTCGTAGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021392
VALIDATED
AP4M1 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 4, mu 1 subunit
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382493    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021392.4-1547s21c1
Sequence:GTACCGGCAATGTGAGCAGGCAGTTGAACTCGAGTTCAACTGCCTGCTCACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021392.4-1531s21c1
Sequence:GTACCGGGCAAGGATATGGACAGCAATGCTCGAGCATTGCTGTCCATATCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021392.4-1498s21c1
Sequence:CCGGACGCCTACGTAATTCGGATTTCTCGAGAAATCCGAATTACGTAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021392.4-1563s21c1
Sequence:CCGGTTGAACAGGAAGAGGACATTTCTCGAGAAATGTCCTCTTCCTGTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021392.4-347s21c1
Sequence:CCGGCAGACACAGTGGGCTCTATTTCTCGAGAAATAGAGCCCACTGTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021392.4-850s21c1
Sequence:CCGGGCATTGGCTTGACAGAAGAATCTCGAGATTCTTCTGTCAAGCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021392.4-309s21c1
Sequence:CCGGGTTGTCATGTATCACGGTGATCTCGAGATCACCGTGATACATGACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021392.4-756s21c1
Sequence:GTACCGGTCTGTACTGATTGCATCTAATCTCGAGATTAGATGCAATCAGTACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021392.4-883s21c1
Sequence:GTACCGGAGTCAGAACTGAGAGGTTATGCTCGAGCATAACCTCTCAGTTCTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111695    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021392.2-1533s1c1
Sequence:CCGGAGCAAGGATATGGACAGCAATCTCGAGATTGCTGTCCATATCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021392.2-312s1c1
Sequence:CCGGGTTGTCATGTATCACGGTGATCTCGAGATCACCGTGATACATGACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021392.2-853s1c1
Sequence:CCGGGCATTGGCTTGACAGAAGAATCTCGAGATTCTTCTGTCAAGCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021392.2-642s1c1
Sequence:CCGGGCAGAGACACAGCAGAATAAACTCGAGTTTATTCTGCTGTGTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021392.2-495s1c1
Sequence:CCGGCTTGTCTACGAACTCCTGGATCTCGAGATCCAGGAGTTCGTAGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021392
VALIDATED
AP4M1 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 4, mu 1 subunit
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382493    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021392.4-1547s21c1
Sequence:GTACCGGCAATGTGAGCAGGCAGTTGAACTCGAGTTCAACTGCCTGCTCACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021392.4-1531s21c1
Sequence:GTACCGGGCAAGGATATGGACAGCAATGCTCGAGCATTGCTGTCCATATCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021392.4-1498s21c1
Sequence:CCGGACGCCTACGTAATTCGGATTTCTCGAGAAATCCGAATTACGTAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304790    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021392.4-1563s21c1
Sequence:CCGGTTGAACAGGAAGAGGACATTTCTCGAGAAATGTCCTCTTCCTGTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021392.4-347s21c1
Sequence:CCGGCAGACACAGTGGGCTCTATTTCTCGAGAAATAGAGCCCACTGTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021392.4-850s21c1
Sequence:CCGGGCATTGGCTTGACAGAAGAATCTCGAGATTCTTCTGTCAAGCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021392.4-309s21c1
Sequence:CCGGGTTGTCATGTATCACGGTGATCTCGAGATCACCGTGATACATGACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021392.4-756s21c1
Sequence:GTACCGGTCTGTACTGATTGCATCTAATCTCGAGATTAGATGCAATCAGTACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021392.4-883s21c1
Sequence:GTACCGGAGTCAGAACTGAGAGGTTATGCTCGAGCATAACCTCTCAGTTCTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111695    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021392.2-1533s1c1
Sequence:CCGGAGCAAGGATATGGACAGCAATCTCGAGATTGCTGTCCATATCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021392.2-312s1c1
Sequence:CCGGGTTGTCATGTATCACGGTGATCTCGAGATCACCGTGATACATGACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021392.2-853s1c1
Sequence:CCGGGCATTGGCTTGACAGAAGAATCTCGAGATTCTTCTGTCAAGCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021392.2-642s1c1
Sequence:CCGGGCAGAGACACAGCAGAATAAACTCGAGTTTATTCTGCTGTGTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021392.2-495s1c1
Sequence:CCGGCTTGTCTACGAACTCCTGGATCTCGAGATCCAGGAGTTCGTAGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004722
VALIDATED
AP4M1 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 4, mu 1 subunit
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004722.3-586s21c1
Sequence:GTACCGGCACGGAGATGCTGAGGAATTTCTCGAGAAATTCCTCAGCATCTCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004722.3-773s21c1
Sequence:GTACCGGTTGGATGTGGTCGAGAGATTGCTCGAGCAATCTCTCGACCACATCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004722.3-921s21c1
Sequence:GTACCGGAGTCAGAGCTGAGAGGTTATGCTCGAGCATAACCTCTCAGCTCTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004722.3-517s21c1
Sequence:GTACCGGCCGCAATGTGGCTCTGGTATACTCGAGTATACCAGAGCCACATTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381560    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004722.3-1616s21c1
Sequence:GTACCGGACGGGAGGACAGTCGTTTCTTCTCGAGAAGAAACGACTGTCCTCCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_004722.2-1089s1c1
Sequence:CCGGGCTCCAGGTTTATCTAAAGTTCTCGAGAACTTTAGATAAACCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004722.2-467s1c1
Sequence:CCGGCCCGCAATGTGGCTCTGGTATCTCGAGATACCAGAGCCACATTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004722.2-940s1c1
Sequence:CCGGCTGGACGAATTTGAGTCTCATCTCGAGATGAGACTCAAATTCGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004722.2-347s1c1
Sequence:CCGGGCCTCTATTTGGTGGTCACAACTCGAGTTGTGACCACCAAATAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004722.2-904s1c1
Sequence:CCGGCGGGTCGATGAAGTCTCGTTTCTCGAGAAACGAGACTTCATCGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004722
VALIDATED
AP4M1 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 4, mu 1 subunit
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004722.3-586s21c1
Sequence:GTACCGGCACGGAGATGCTGAGGAATTTCTCGAGAAATTCCTCAGCATCTCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004722.3-773s21c1
Sequence:GTACCGGTTGGATGTGGTCGAGAGATTGCTCGAGCAATCTCTCGACCACATCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004722.3-921s21c1
Sequence:GTACCGGAGTCAGAGCTGAGAGGTTATGCTCGAGCATAACCTCTCAGCTCTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004722.3-517s21c1
Sequence:GTACCGGCCGCAATGTGGCTCTGGTATACTCGAGTATACCAGAGCCACATTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381560    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004722.3-1616s21c1
Sequence:GTACCGGACGGGAGGACAGTCGTTTCTTCTCGAGAAGAAACGACTGTCCTCCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_004722.2-1089s1c1
Sequence:CCGGGCTCCAGGTTTATCTAAAGTTCTCGAGAACTTTAGATAAACCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004722.2-467s1c1
Sequence:CCGGCCCGCAATGTGGCTCTGGTATCTCGAGATACCAGAGCCACATTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004722.2-940s1c1
Sequence:CCGGCTGGACGAATTTGAGTCTCATCTCGAGATGAGACTCAAATTCGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004722.2-347s1c1
Sequence:CCGGGCCTCTATTTGGTGGTCACAACTCGAGTTGTGACCACCAAATAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004722.2-904s1c1
Sequence:CCGGCGGGTCGATGAAGTCTCGTTTCTCGAGAAACGAGACTTCATCGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004722
VALIDATED
AP4M1 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 4, mu 1 subunit
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004722.3-586s21c1
Sequence:GTACCGGCACGGAGATGCTGAGGAATTTCTCGAGAAATTCCTCAGCATCTCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004722.3-773s21c1
Sequence:GTACCGGTTGGATGTGGTCGAGAGATTGCTCGAGCAATCTCTCGACCACATCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004722.3-921s21c1
Sequence:GTACCGGAGTCAGAGCTGAGAGGTTATGCTCGAGCATAACCTCTCAGCTCTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004722.3-517s21c1
Sequence:GTACCGGCCGCAATGTGGCTCTGGTATACTCGAGTATACCAGAGCCACATTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381560    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004722.3-1616s21c1
Sequence:GTACCGGACGGGAGGACAGTCGTTTCTTCTCGAGAAGAAACGACTGTCCTCCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_004722.2-1089s1c1
Sequence:CCGGGCTCCAGGTTTATCTAAAGTTCTCGAGAACTTTAGATAAACCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004722.2-467s1c1
Sequence:CCGGCCCGCAATGTGGCTCTGGTATCTCGAGATACCAGAGCCACATTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004722.2-940s1c1
Sequence:CCGGCTGGACGAATTTGAGTCTCATCTCGAGATGAGACTCAAATTCGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004722.2-347s1c1
Sequence:CCGGGCCTCTATTTGGTGGTCACAACTCGAGTTGTGACCACCAAATAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004722.2-904s1c1
Sequence:CCGGCGGGTCGATGAAGTCTCGTTTCTCGAGAAACGAGACTTCATCGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks