EMAIL THIS PAGE TO A FRIEND

AP4S1

adaptor-related protein complex 4, sigma 1 subunit

75 Gene Product Result for
Synonyms: AP47B CLA20 CLAPS4 CPSQ6 SPG52
UniProtKB ID: Q9Y587, G3V2N8, Q6IAQ4, Q86U36, Q9BVE7
Gene ID:
Human(11154) Summary: This gene encodes a member of the adaptor complexes small subunit protein family. These proteins are components of the heterotetrameric adaptor protein complexes, which play important roles in the secretory and endocytic pathways by mediating vesicle formation and sorting of integral membrane proteins. The encoded protein is the small subunit of adaptor protein complex-4, which is associated with both clathrin- and nonclathrin-coated vesicles. Mutations in this gene are associated with spastic quadriplegic cerebral palsy-6. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 6. [provided by RefSeq, Dec 2011]
Mouse(11782) adaptor-related protein complex AP-4, sigma 1
Rat(366618) adaptor-related protein complex 4, sigma 1 subunit
naked mole-rat(101699663) adaptor-related protein complex 4, sigma 1 subunit
domestic guinea pig(100713810) adaptor-related protein complex 4, sigma 1 subunit
sheep(101115405) adaptor-related protein complex 4, sigma 1 subunit
Zebrafish(368852) adaptor-related protein complex 4, sigma 1 subunit
dog(480283) adaptor-related protein complex 4, sigma 1 subunit
domestic cat(101086729) adaptor-related protein complex 4, sigma 1 subunit
chicken(423309) adaptor-related protein complex 4, sigma 1 subunit
cow(618267) adaptor-related protein complex 4, sigma 1 subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007077 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007077 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007077 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021710 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021710 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021710 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001128126 Rosetta Predictions human pricing
NM_007077 Rosetta Predictions human pricing
NM_001130999 Rosetta Predictions rat pricing
XM_345668 Rosetta Predictions rat pricing
NM_021710 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128126 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330516 predicted 868
2 SASI_Hs02_00330517 predicted 555
3 SASI_Hs02_00330518 predicted 833
4 SASI_Hs02_00330519 predicted 427
5 SASI_Hs02_00330520 predicted 437
6 SASI_Hs02_00330521 predicted 754
7 SASI_Hs02_00330522 predicted 461
8 SASI_Hs02_00330523 predicted 479
9 SASI_Hs02_00330524 predicted 891
10 SASI_Hs02_00330525 predicted 416
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007077 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217979 predicted 467
2 SASI_Hs01_00217980 predicted 796
3 SASI_Hs01_00217981 predicted 953
4 SASI_Hs01_00217982 predicted 945
5 SASI_Hs01_00217984 predicted 353
6 SASI_Hs01_00217985 predicted 216
7 SASI_Hs01_00217986 predicted 224
8 SASI_Hs02_00342903 predicted 697
9 SASI_Hs01_00217987 predicted 248
10 SASI_Hs01_00217988 predicted 273
11 SASI_Hs01_00217983 predicted 382
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130999 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256109 predicted 475
2 SASI_Rn02_00256110 predicted 386
3 SASI_Rn02_00256111 predicted 241
4 SASI_Rn02_00256112 predicted 584
5 SASI_Rn02_00256113 predicted 473
6 SASI_Rn02_00256114 predicted 317
7 SASI_Rn02_00256115 predicted 421
8 SASI_Rn02_00256116 predicted 536
9 SASI_Rn02_00256117 predicted 322
10 SASI_Rn02_00256118 predicted 483
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345668 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00129325 predicted 229
2 SASI_Rn01_00129326 predicted 211
3 SASI_Rn01_00129327 predicted 230
4 SASI_Rn01_00129328 predicted 240
5 SASI_Rn01_00129329 predicted 237
6 SASI_Rn01_00129330 predicted 238
7 SASI_Rn01_00129331 predicted 221
8 SASI_Rn01_00129332 predicted 232
9 SASI_Rn01_00129333 predicted 241
10 SASI_Rn01_00129334 predicted 229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021710 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159915 predicted 624
2 SASI_Mm01_00159916 predicted 831
3 SASI_Mm02_00326389 predicted 515
4 SASI_Mm01_00159917 predicted 638
5 SASI_Mm01_00159918 predicted 711
6 SASI_Mm01_00159919 predicted 536
7 SASI_Mm01_00159920 predicted 608
8 SASI_Mm01_00159921 predicted 787
9 SASI_Mm01_00159922 predicted 646
10 SASI_Mm01_00159923 predicted 648
11 SASI_Mm01_00159924 predicted 488
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007077
AP4S1 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 4, sigma 1 subunit
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007077.2-461s1c1
Sequence:CCGGCGAGTGAGTGAATTAGATGTACTCGAGTACATCTAATTCACTCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007077.2-400s1c1
Sequence:CCGGCGAGATGGCTATTTATGAATTCTCGAGAATTCATAAATAGCCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007077.2-215s1c1
Sequence:CCGGCGACTTTCTAAGTACTATGAACTCGAGTTCATAGTACTTAGAAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007077.2-602s1c1
Sequence:CCGGCCAGACAGTTCATCATTCAAACTCGAGTTTGAATGATGAACTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007077.2-514s1c1
Sequence:CCGGGCAAATGCACTCTGGTCCTTACTCGAGTAAGGACCAGAGTGCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007077.3-657s21c1
Sequence:GTACCGGATGAGTATTTCAGCCGAGTGACTCGAGTCACTCGGCTGAAATACTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381226    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007077.3-1208s21c1
Sequence:GTACCGGTTTATAAGGTCCCTAGATATCCTCGAGGATATCTAGGGACCTTATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007077.3-709s21c1
Sequence:GTACCGGTTTCCACAGTACTTGGCAAATCTCGAGATTTGCCAAGTACTGTGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007077.3-673s21c1
Sequence:GTACCGGAGTGAGTGAATTAGATGTATCCTCGAGGATACATCTAATTCACTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007077.3-725s21c1
Sequence:GTACCGGCAAATGCACTCTGGTCCTTATCTCGAGATAAGGACCAGAGTGCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007077.3-809s21c1
Sequence:GTACCGGTCTCCAGACAGTTCATCATTCCTCGAGGAATGATGAACTGTCTGGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007077.3-879s21c1
Sequence:GTACCGGACCAATGAACAGCACAGTATGCTCGAGCATACTGTGCTGTTCATTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007077
AP4S1 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 4, sigma 1 subunit
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007077.2-461s1c1
Sequence:CCGGCGAGTGAGTGAATTAGATGTACTCGAGTACATCTAATTCACTCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007077.2-400s1c1
Sequence:CCGGCGAGATGGCTATTTATGAATTCTCGAGAATTCATAAATAGCCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007077.2-215s1c1
Sequence:CCGGCGACTTTCTAAGTACTATGAACTCGAGTTCATAGTACTTAGAAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007077.2-602s1c1
Sequence:CCGGCCAGACAGTTCATCATTCAAACTCGAGTTTGAATGATGAACTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007077.2-514s1c1
Sequence:CCGGGCAAATGCACTCTGGTCCTTACTCGAGTAAGGACCAGAGTGCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007077.3-657s21c1
Sequence:GTACCGGATGAGTATTTCAGCCGAGTGACTCGAGTCACTCGGCTGAAATACTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381226    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007077.3-1208s21c1
Sequence:GTACCGGTTTATAAGGTCCCTAGATATCCTCGAGGATATCTAGGGACCTTATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007077.3-709s21c1
Sequence:GTACCGGTTTCCACAGTACTTGGCAAATCTCGAGATTTGCCAAGTACTGTGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007077.3-673s21c1
Sequence:GTACCGGAGTGAGTGAATTAGATGTATCCTCGAGGATACATCTAATTCACTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007077.3-725s21c1
Sequence:GTACCGGCAAATGCACTCTGGTCCTTATCTCGAGATAAGGACCAGAGTGCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007077.3-809s21c1
Sequence:GTACCGGTCTCCAGACAGTTCATCATTCCTCGAGGAATGATGAACTGTCTGGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007077.3-879s21c1
Sequence:GTACCGGACCAATGAACAGCACAGTATGCTCGAGCATACTGTGCTGTTCATTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007077
AP4S1 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 4, sigma 1 subunit
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007077.2-461s1c1
Sequence:CCGGCGAGTGAGTGAATTAGATGTACTCGAGTACATCTAATTCACTCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007077.2-400s1c1
Sequence:CCGGCGAGATGGCTATTTATGAATTCTCGAGAATTCATAAATAGCCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007077.2-215s1c1
Sequence:CCGGCGACTTTCTAAGTACTATGAACTCGAGTTCATAGTACTTAGAAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007077.2-602s1c1
Sequence:CCGGCCAGACAGTTCATCATTCAAACTCGAGTTTGAATGATGAACTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007077.2-514s1c1
Sequence:CCGGGCAAATGCACTCTGGTCCTTACTCGAGTAAGGACCAGAGTGCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007077.3-657s21c1
Sequence:GTACCGGATGAGTATTTCAGCCGAGTGACTCGAGTCACTCGGCTGAAATACTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381226    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007077.3-1208s21c1
Sequence:GTACCGGTTTATAAGGTCCCTAGATATCCTCGAGGATATCTAGGGACCTTATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007077.3-709s21c1
Sequence:GTACCGGTTTCCACAGTACTTGGCAAATCTCGAGATTTGCCAAGTACTGTGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007077.3-673s21c1
Sequence:GTACCGGAGTGAGTGAATTAGATGTATCCTCGAGGATACATCTAATTCACTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007077.3-725s21c1
Sequence:GTACCGGCAAATGCACTCTGGTCCTTATCTCGAGATAAGGACCAGAGTGCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007077.3-809s21c1
Sequence:GTACCGGTCTCCAGACAGTTCATCATTCCTCGAGGAATGATGAACTGTCTGGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007077.3-879s21c1
Sequence:GTACCGGACCAATGAACAGCACAGTATGCTCGAGCATACTGTGCTGTTCATTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021710
VALIDATED
AP4S1 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 4, sigma 1 subunit
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113120    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021710.1-816s1c1
Sequence:CCGGGCCAAGGAAGAGATCATGGATCTCGAGATCCATGATCTCTTCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021710.1-527s1c1
Sequence:CCGGCGGCAATATGCAGCTCTCTTTCTCGAGAAAGAGAGCTGCATATTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021710.1-636s1c1
Sequence:CCGGGCCGAGTGAGTGAATTAGATACTCGAGTATCTAATTCACTCACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021710.1-571s1c1
Sequence:CCGGTGAGAATGAGATGGCTATCTACTCGAGTAGATAGCCATCTCATTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021710.1-578s1c1
Sequence:CCGGGAGATGGCTATCTATGAATTTCTCGAGAAATTCATAGATAGCCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021710
VALIDATED
AP4S1 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 4, sigma 1 subunit
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113120    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021710.1-816s1c1
Sequence:CCGGGCCAAGGAAGAGATCATGGATCTCGAGATCCATGATCTCTTCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021710.1-527s1c1
Sequence:CCGGCGGCAATATGCAGCTCTCTTTCTCGAGAAAGAGAGCTGCATATTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021710.1-636s1c1
Sequence:CCGGGCCGAGTGAGTGAATTAGATACTCGAGTATCTAATTCACTCACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021710.1-571s1c1
Sequence:CCGGTGAGAATGAGATGGCTATCTACTCGAGTAGATAGCCATCTCATTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021710.1-578s1c1
Sequence:CCGGGAGATGGCTATCTATGAATTTCTCGAGAAATTCATAGATAGCCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021710
VALIDATED
AP4S1 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 4, sigma 1 subunit
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113120    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021710.1-816s1c1
Sequence:CCGGGCCAAGGAAGAGATCATGGATCTCGAGATCCATGATCTCTTCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021710.1-527s1c1
Sequence:CCGGCGGCAATATGCAGCTCTCTTTCTCGAGAAAGAGAGCTGCATATTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021710.1-636s1c1
Sequence:CCGGGCCGAGTGAGTGAATTAGATACTCGAGTATCTAATTCACTCACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021710.1-571s1c1
Sequence:CCGGTGAGAATGAGATGGCTATCTACTCGAGTAGATAGCCATCTCATTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021710.1-578s1c1
Sequence:CCGGGAGATGGCTATCTATGAATTTCTCGAGAAATTCATAGATAGCCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks