EMAIL THIS PAGE TO A FRIEND

AP5B1

adaptor-related protein complex 5, beta 1 subunit

81 Gene Product Result for
Synonyms: AP-5 PP1030
UniProtKB ID: Q2VPB7, A1L0S6, H6WUK2, Q0D2Q2, Q8N3J7, Q8WYH6
Gene ID:
Mouse(381201) adaptor-related protein complex 5, beta 1 subunit
Rat(361709) adaptor-related protein complex 5, beta 1 subunit
domestic cat(101096844) adaptor-related protein complex 5, beta 1 subunit
dog(476023) adaptor-related protein complex 5, beta 1 subunit
cow(509087) adaptor-related protein complex 5, beta 1 subunit
sheep(101102439) adaptor-related protein complex 5, beta 1 subunit
domestic guinea pig(100724643) adaptor-related protein complex 5, beta 1 subunit
naked mole-rat(101714752) adaptor-related protein complex 5, beta 1 subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138368 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138368 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138368 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033448 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033448 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033448 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU154701 MISSION® esiRNA esiRNA targeting mouse Gm962 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138368 Rosetta Predictions human pricing
XM_001073814 Rosetta Predictions rat pricing
XM_341994 Rosetta Predictions rat pricing
NM_001033448 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138368 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363477 predicted 1514
2 SASI_Hs02_00363478 predicted 789
3 SASI_Hs01_00064801 predicted 1062
4 SASI_Hs02_00363479 predicted 433
5 SASI_Hs01_00064803 predicted 1675
6 SASI_Hs02_00363480 predicted 810
7 SASI_Hs02_00363481 predicted 415
8 SASI_Hs02_00363482 predicted 680
9 SASI_Hs01_00064805 predicted 1106
10 SASI_Hs01_00064806 predicted 2081
11 SASI_Hs01_00064800 predicted 1245
12 SASI_Hs01_00064802 predicted 895
13 SASI_Hs01_00064804 predicted 1523
14 SASI_Hs01_00064807 predicted 574
15 SASI_Hs01_00064808 predicted 1859
16 SASI_Hs01_00064809 predicted 1935
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073814 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00344044 predicted 825
2 SASI_Rn02_00344045 predicted 510
3 SASI_Rn02_00344046 predicted 256
4 SASI_Rn02_00344047 predicted 1482
5 SASI_Rn02_00344048 predicted 1316
6 SASI_Rn02_00344049 predicted 1035
7 SASI_Rn02_00344050 predicted 1023
8 SASI_Rn02_00344051 predicted 1900
9 SASI_Rn02_00344052 predicted 999
10 SASI_Rn02_00344053 predicted 1597
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341994 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393644 predicted 488
2 SASI_Rn02_00393645 predicted 1628
3 SASI_Rn02_00393646 predicted 1754
4 SASI_Rn02_00393647 predicted 817
5 SASI_Rn02_00393648 predicted 506
6 SASI_Rn02_00393649 predicted 256
7 SASI_Rn02_00393650 predicted 1480
8 SASI_Rn02_00393651 predicted 1185
9 SASI_Rn02_00393652 predicted 1029
10 SASI_Rn02_00393653 predicted 1586
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033448 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188229 predicted 666
2 SASI_Mm01_00188230 predicted 2653
3 SASI_Mm01_00188231 predicted 2826
4 SASI_Mm01_00188233 predicted 2206
5 SASI_Mm01_00188236 predicted 1784
6 SASI_Mm01_00188237 predicted 1333
7 SASI_Mm01_00188238 predicted 1588
8 SASI_Mm02_00288769 predicted 1884
9 SASI_Mm02_00288770 predicted 1900
10 SASI_Mm02_00288771 predicted 1235
11 SASI_Mm01_00188232 predicted 2234
12 SASI_Mm01_00188234 predicted 571
13 SASI_Mm01_00188235 predicted 473
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138368
AP5B1 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 5, beta 1 subunit
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138368.3-1069s21c1
Sequence:CCGGAGTCTCCTGCATGACCCAATGCTCGAGCATTGGGTCATGCAGGAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138368.3-1517s21c1
Sequence:CCGGAGAGTGCTACCCTCAACTTTCCTCGAGGAAAGTTGAGGGTAGCACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436165    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138368.3-2927s21c1
Sequence:CCGGGTTACAGTGGCAATCGCATTTCTCGAGAAATGCGATTGCCACTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138368.2-1086s1c1
Sequence:CCGGCACTTTGTGGACCTCTTGGATCTCGAGATCCAAGAGGTCCACAAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165852    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138368.2-3452s1c1
Sequence:CCGGGCTTAGGAATCTTCCCAGGTACTCGAGTACCTGGGAAGATTCCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138368.2-852s1c1
Sequence:CCGGGAGGAGGAAGAAGAGGAGAAACTCGAGTTTCTCCTCTTCTTCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164578    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138368.2-3465s1c1
Sequence:CCGGCCCAGGTAAGAAGAACTAGTTCTCGAGAACTAGTTCTTCTTACCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162655    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138368.2-3984s1c1
Sequence:CCGGCGAAACCCTGTGTCTAATAAACTCGAGTTTATTAGACACAGGGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165218    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138368.2-3235s1c1
Sequence:CCGGGCTTCTCAACTCCCAAGGTTTCTCGAGAAACCTTGGGAGTTGAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138368.2-1860s1c1
Sequence:CCGGGTGAACTTTGCCGACCTCTTTCTCGAGAAAGAGGTCGGCAAAGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165583    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138368.2-2747s1c1
Sequence:CCGGGCACTGTAGAGCTACAGAGTTCTCGAGAACTCTGTAGCTCTACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138368
AP5B1 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 5, beta 1 subunit
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138368.3-1069s21c1
Sequence:CCGGAGTCTCCTGCATGACCCAATGCTCGAGCATTGGGTCATGCAGGAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138368.3-1517s21c1
Sequence:CCGGAGAGTGCTACCCTCAACTTTCCTCGAGGAAAGTTGAGGGTAGCACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436165    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138368.3-2927s21c1
Sequence:CCGGGTTACAGTGGCAATCGCATTTCTCGAGAAATGCGATTGCCACTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138368.2-1086s1c1
Sequence:CCGGCACTTTGTGGACCTCTTGGATCTCGAGATCCAAGAGGTCCACAAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165852    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138368.2-3452s1c1
Sequence:CCGGGCTTAGGAATCTTCCCAGGTACTCGAGTACCTGGGAAGATTCCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138368.2-852s1c1
Sequence:CCGGGAGGAGGAAGAAGAGGAGAAACTCGAGTTTCTCCTCTTCTTCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164578    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138368.2-3465s1c1
Sequence:CCGGCCCAGGTAAGAAGAACTAGTTCTCGAGAACTAGTTCTTCTTACCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162655    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138368.2-3984s1c1
Sequence:CCGGCGAAACCCTGTGTCTAATAAACTCGAGTTTATTAGACACAGGGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165218    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138368.2-3235s1c1
Sequence:CCGGGCTTCTCAACTCCCAAGGTTTCTCGAGAAACCTTGGGAGTTGAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138368.2-1860s1c1
Sequence:CCGGGTGAACTTTGCCGACCTCTTTCTCGAGAAAGAGGTCGGCAAAGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165583    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138368.2-2747s1c1
Sequence:CCGGGCACTGTAGAGCTACAGAGTTCTCGAGAACTCTGTAGCTCTACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138368
AP5B1 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 5, beta 1 subunit
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138368.3-1069s21c1
Sequence:CCGGAGTCTCCTGCATGACCCAATGCTCGAGCATTGGGTCATGCAGGAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138368.3-1517s21c1
Sequence:CCGGAGAGTGCTACCCTCAACTTTCCTCGAGGAAAGTTGAGGGTAGCACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436165    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138368.3-2927s21c1
Sequence:CCGGGTTACAGTGGCAATCGCATTTCTCGAGAAATGCGATTGCCACTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166549    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138368.2-1086s1c1
Sequence:CCGGCACTTTGTGGACCTCTTGGATCTCGAGATCCAAGAGGTCCACAAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165852    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138368.2-3452s1c1
Sequence:CCGGGCTTAGGAATCTTCCCAGGTACTCGAGTACCTGGGAAGATTCCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138368.2-852s1c1
Sequence:CCGGGAGGAGGAAGAAGAGGAGAAACTCGAGTTTCTCCTCTTCTTCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164578    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138368.2-3465s1c1
Sequence:CCGGCCCAGGTAAGAAGAACTAGTTCTCGAGAACTAGTTCTTCTTACCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162655    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138368.2-3984s1c1
Sequence:CCGGCGAAACCCTGTGTCTAATAAACTCGAGTTTATTAGACACAGGGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165218    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138368.2-3235s1c1
Sequence:CCGGGCTTCTCAACTCCCAAGGTTTCTCGAGAAACCTTGGGAGTTGAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138368.2-1860s1c1
Sequence:CCGGGTGAACTTTGCCGACCTCTTTCTCGAGAAAGAGGTCGGCAAAGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165583    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138368.2-2747s1c1
Sequence:CCGGGCACTGTAGAGCTACAGAGTTCTCGAGAACTCTGTAGCTCTACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033448
AP5B1 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 5, beta 1 subunit
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000183041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033448.1-1784s1c1
Sequence:CCGGCCTCATACCTTGTTACTAACTCTCGAGAGTTAGTAACAAGGTATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033448.1-2217s1c1
Sequence:CCGGCCGACTATACTATGTCCTCTTCTCGAGAAGAGGACATAGTATAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033448.1-1792s1c1
Sequence:CCGGCTTGTTACTAACTGCCTGACTCTCGAGAGTCAGGCAGTTAGTAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033448
AP5B1 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 5, beta 1 subunit
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000183041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033448.1-1784s1c1
Sequence:CCGGCCTCATACCTTGTTACTAACTCTCGAGAGTTAGTAACAAGGTATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033448.1-2217s1c1
Sequence:CCGGCCGACTATACTATGTCCTCTTCTCGAGAAGAGGACATAGTATAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033448.1-1792s1c1
Sequence:CCGGCTTGTTACTAACTGCCTGACTCTCGAGAGTCAGGCAGTTAGTAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033448
AP5B1 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 5, beta 1 subunit
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000183041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033448.1-1784s1c1
Sequence:CCGGCCTCATACCTTGTTACTAACTCTCGAGAGTTAGTAACAAGGTATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033448.1-2217s1c1
Sequence:CCGGCCGACTATACTATGTCCTCTTCTCGAGAAGAGGACATAGTATAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033448.1-1792s1c1
Sequence:CCGGCTTGTTACTAACTGCCTGACTCTCGAGAGTCAGGCAGTTAGTAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks