EMAIL THIS PAGE TO A FRIEND

AP5M1

adaptor-related protein complex 5, mu 1 subunit

74 Gene Product Result for
Synonyms: C14orf108 MUDENG Mu5 MuD
UniProtKB ID: Q9H0R1, O95354, Q6ZMD7, Q96DX3, Q9NVC5
Gene ID:
Mouse(74385) adaptor-related protein complex 5, mu 1 subunit
Rat(305861) adaptor-related protein complex 5, mu 1 subunit
naked mole-rat(101697870) adaptor-related protein complex 5, mu 1 subunit
domestic guinea pig(100727689) adaptor-related protein complex 5, mu 1 subunit
sheep(101121268) adaptor-related protein complex 5, mu 1 subunit
Zebrafish(553681) adaptor-related protein complex 5, mu 1 subunit
domestic cat(101095022) adaptor-related protein complex 5, mu 1 subunit
cow(539663) MU-2/AP1M2 domain containing, death-inducing
dog(490711) adaptor-related protein complex 5, mu 1 subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018229 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018229 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018229 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144535 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144535 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144535 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU042471 MISSION® esiRNA esiRNA human C14orf108 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018229 Rosetta Predictions human pricing
NM_001030036 Rosetta Predictions rat pricing
NM_144535 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018229 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239722 predicted 620
2 SASI_Hs02_00351549 predicted 1706
3 SASI_Hs01_00239724 predicted 1683
4 SASI_Hs01_00239725 predicted 1875
5 SASI_Hs01_00239726 predicted 925
6 SASI_Hs01_00239727 predicted 1558
7 SASI_Hs01_00239728 predicted 644
8 SASI_Hs01_00239729 predicted 1489
9 SASI_Hs01_00239730 predicted 1484
10 SASI_Hs01_00239731 predicted 1721
11 SASI_Hs01_00239723 predicted 1850
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030036 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120525 predicted 283
2 SASI_Rn01_00120526 predicted 1566
3 SASI_Rn01_00120528 predicted 1503
4 SASI_Rn02_00203545 predicted 435
5 SASI_Rn01_00120529 predicted 1253
6 SASI_Rn01_00120530 predicted 1376
7 SASI_Rn01_00120531 predicted 1733
8 SASI_Rn01_00120532 predicted 1072
9 SASI_Rn01_00120533 predicted 1473
10 SASI_Rn01_00120534 predicted 1011
11 SASI_Rn01_00120527 predicted 1322
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144535 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079424 predicted 312
2 SASI_Mm01_00079425 predicted 1746
3 SASI_Mm01_00079426 predicted 1574
4 SASI_Mm01_00079427 predicted 1424
5 SASI_Mm01_00079428 predicted 1478
6 SASI_Mm01_00079429 predicted 1469
7 SASI_Mm01_00079430 predicted 1120
8 SASI_Mm01_00079431 predicted 1133
9 SASI_Mm02_00340067 predicted 1494
10 SASI_Mm01_00079432 predicted 756
11 SASI_Mm01_00079433 predicted 1520
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018229
VALIDATED
AP5M1 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 5, mu 1 subunit
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018229.2-929s1c1
Sequence:CCGGGCCAACTTACAGAATTCATTACTCGAGTAATGAATTCTGTAAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_018229.2-1066s1c1
Sequence:CCGGGCAATATGATAAACAGGGTATCTCGAGATACCCTGTTTATCATATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_018229.2-1799s1c1
Sequence:CCGGCGGAAACTAATTTCTTCTGATCTCGAGATCAGAAGAAATTAGTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_018229.2-1850s1c1
Sequence:CCGGCCAGTAACATATGGATCATTACTCGAGTAATGATCCATATGTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_018229.2-567s1c1
Sequence:CCGGCACTGCTCTTTGAACTTAGATCTCGAGATCTAAGTTCAAAGAGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_018229.3-1871s21c1
Sequence:CCGGCCAGTAACATATGGATCATTACTCGAGTAATGATCCATATGTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_018229.3-588s21c1
Sequence:CCGGCACTGCTCTTTGAACTTAGATCTCGAGATCTAAGTTCAAAGAGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_018229.3-1820s21c1
Sequence:CCGGCGGAAACTAATTTCTTCTGATCTCGAGATCAGAAGAAATTAGTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_018229.3-950s21c1
Sequence:CCGGGCCAACTTACAGAATTCATTACTCGAGTAATGAATTCTGTAAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018229
VALIDATED
AP5M1 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 5, mu 1 subunit
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018229.2-929s1c1
Sequence:CCGGGCCAACTTACAGAATTCATTACTCGAGTAATGAATTCTGTAAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_018229.2-1066s1c1
Sequence:CCGGGCAATATGATAAACAGGGTATCTCGAGATACCCTGTTTATCATATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_018229.2-1799s1c1
Sequence:CCGGCGGAAACTAATTTCTTCTGATCTCGAGATCAGAAGAAATTAGTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_018229.2-1850s1c1
Sequence:CCGGCCAGTAACATATGGATCATTACTCGAGTAATGATCCATATGTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_018229.2-567s1c1
Sequence:CCGGCACTGCTCTTTGAACTTAGATCTCGAGATCTAAGTTCAAAGAGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_018229.3-1871s21c1
Sequence:CCGGCCAGTAACATATGGATCATTACTCGAGTAATGATCCATATGTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_018229.3-588s21c1
Sequence:CCGGCACTGCTCTTTGAACTTAGATCTCGAGATCTAAGTTCAAAGAGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_018229.3-1820s21c1
Sequence:CCGGCGGAAACTAATTTCTTCTGATCTCGAGATCAGAAGAAATTAGTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_018229.3-950s21c1
Sequence:CCGGGCCAACTTACAGAATTCATTACTCGAGTAATGAATTCTGTAAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018229
VALIDATED
AP5M1 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 5, mu 1 subunit
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018229.2-929s1c1
Sequence:CCGGGCCAACTTACAGAATTCATTACTCGAGTAATGAATTCTGTAAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_018229.2-1066s1c1
Sequence:CCGGGCAATATGATAAACAGGGTATCTCGAGATACCCTGTTTATCATATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_018229.2-1799s1c1
Sequence:CCGGCGGAAACTAATTTCTTCTGATCTCGAGATCAGAAGAAATTAGTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_018229.2-1850s1c1
Sequence:CCGGCCAGTAACATATGGATCATTACTCGAGTAATGATCCATATGTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_018229.2-567s1c1
Sequence:CCGGCACTGCTCTTTGAACTTAGATCTCGAGATCTAAGTTCAAAGAGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_018229.3-1871s21c1
Sequence:CCGGCCAGTAACATATGGATCATTACTCGAGTAATGATCCATATGTTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_018229.3-588s21c1
Sequence:CCGGCACTGCTCTTTGAACTTAGATCTCGAGATCTAAGTTCAAAGAGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_018229.3-1820s21c1
Sequence:CCGGCGGAAACTAATTTCTTCTGATCTCGAGATCAGAAGAAATTAGTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_018229.3-950s21c1
Sequence:CCGGGCCAACTTACAGAATTCATTACTCGAGTAATGAATTCTGTAAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144535
VALIDATED
AP5M1 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 5, mu 1 subunit
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144535.2-1636s1c1
Sequence:CCGGCGGAAACTAATTTCTTCTGATCTCGAGATCAGAAGAAATTAGTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_144535.2-303s1c1
Sequence:CCGGCGTCAGATTCTCCAGACGATACTCGAGTATCGTCTGGAGAATCTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144535.2-1200s1c1
Sequence:CCGGCCCACCAATACTGGGTTCTTACTCGAGTAAGAACCCAGTATTGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192559    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144535.2-1925s1c1
Sequence:CCGGGCTCTGATTTCATGCCAGTATCTCGAGATACTGGCATGAAATCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144535.4-356s21c1
Sequence:CCGGCGTCAGATTCTCCAGACGATACTCGAGTATCGTCTGGAGAATCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340784    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144535.4-1978s21c1
Sequence:CCGGGCTCTGATTTCATGCCAGTATCTCGAGATACTGGCATGAAATCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144535.4-1170s21c1
Sequence:CCGGGCATTTAGTGGGCCGTATAAACTCGAGTTTATACGGCCCACTAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144535.4-1565s21c1
Sequence:CCGGTATTGGAAATACAGCGTATATCTCGAGATATACGCTGTATTTCCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144535
VALIDATED
AP5M1 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 5, mu 1 subunit
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144535.2-1636s1c1
Sequence:CCGGCGGAAACTAATTTCTTCTGATCTCGAGATCAGAAGAAATTAGTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_144535.2-303s1c1
Sequence:CCGGCGTCAGATTCTCCAGACGATACTCGAGTATCGTCTGGAGAATCTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144535.2-1200s1c1
Sequence:CCGGCCCACCAATACTGGGTTCTTACTCGAGTAAGAACCCAGTATTGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192559    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144535.2-1925s1c1
Sequence:CCGGGCTCTGATTTCATGCCAGTATCTCGAGATACTGGCATGAAATCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144535.4-356s21c1
Sequence:CCGGCGTCAGATTCTCCAGACGATACTCGAGTATCGTCTGGAGAATCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340784    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144535.4-1978s21c1
Sequence:CCGGGCTCTGATTTCATGCCAGTATCTCGAGATACTGGCATGAAATCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144535.4-1170s21c1
Sequence:CCGGGCATTTAGTGGGCCGTATAAACTCGAGTTTATACGGCCCACTAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144535.4-1565s21c1
Sequence:CCGGTATTGGAAATACAGCGTATATCTCGAGATATACGCTGTATTTCCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144535
VALIDATED
AP5M1 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 5, mu 1 subunit
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144535.2-1636s1c1
Sequence:CCGGCGGAAACTAATTTCTTCTGATCTCGAGATCAGAAGAAATTAGTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_144535.2-303s1c1
Sequence:CCGGCGTCAGATTCTCCAGACGATACTCGAGTATCGTCTGGAGAATCTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144535.2-1200s1c1
Sequence:CCGGCCCACCAATACTGGGTTCTTACTCGAGTAAGAACCCAGTATTGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192559    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144535.2-1925s1c1
Sequence:CCGGGCTCTGATTTCATGCCAGTATCTCGAGATACTGGCATGAAATCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144535.4-356s21c1
Sequence:CCGGCGTCAGATTCTCCAGACGATACTCGAGTATCGTCTGGAGAATCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340784    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144535.4-1978s21c1
Sequence:CCGGGCTCTGATTTCATGCCAGTATCTCGAGATACTGGCATGAAATCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144535.4-1170s21c1
Sequence:CCGGGCATTTAGTGGGCCGTATAAACTCGAGTTTATACGGCCCACTAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144535.4-1565s21c1
Sequence:CCGGTATTGGAAATACAGCGTATATCTCGAGATATACGCTGTATTTCCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks