EMAIL THIS PAGE TO A FRIEND

AP5S1

adaptor-related protein complex 5, sigma 1 subunit

86 Gene Product Result for
Synonyms: C20orf29
UniProtKB ID: Q9NUS5, B3KSD0, D3DVY7
Gene ID:
Mouse(69596) adaptor-related protein 5 complex, sigma 1 subunit
Rat(499893) adaptor-related protein complex 5, sigma 1 subunit
naked mole-rat(101702372) adaptor-related protein complex 5, sigma 1 subunit
domestic guinea pig(100716570) adaptor-related protein complex 5, sigma 1 subunit
sheep(101120100) adaptor-related protein complex 5, sigma 1 subunit
Zebrafish(556111) adaptor-related protein complex 5, sigma 1 subunit
cow(618505) adaptor-related protein complex 5, sigma 1 subunit
domestic cat(101085967) adaptor-related protein complex 5, sigma 1 subunit
dog(609098) adaptor-related protein complex 5, sigma 1 subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027129 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027129 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027129 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018347 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018347 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018347 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018347 Rosetta Predictions human pricing
NM_001134618 Rosetta Predictions rat pricing
NM_027129 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018347 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114486 predicted 711
2 SASI_Hs01_00114487 predicted 271
3 SASI_Hs01_00114488 predicted 605
4 SASI_Hs01_00114489 predicted 507
5 SASI_Hs01_00114490 predicted 859
6 SASI_Hs01_00114491 predicted 268
7 SASI_Hs01_00114492 predicted 739
8 SASI_Hs01_00114493 predicted 830
9 SASI_Hs01_00114494 predicted 814
10 SASI_Hs02_00351799 predicted 685
11 SASI_Hs01_00114495 predicted 310
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134618 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00257659 predicted 538
2 SASI_Rn02_00257660 predicted 688
3 SASI_Rn02_00257661 predicted 699
4 SASI_Rn02_00257662 predicted 333
5 SASI_Rn02_00257663 predicted 722
6 SASI_Rn02_00257664 predicted 777
7 SASI_Rn02_00257665 predicted 697
8 SASI_Rn02_00257666 predicted 858
9 SASI_Rn02_00257667 predicted 895
10 SASI_Rn02_00257668 predicted 651
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027129 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331610 predicted 1153
2 SASI_Mm01_00187382 predicted 1170
3 SASI_Mm01_00187383 predicted 1055
4 SASI_Mm01_00187384 predicted 1111
5 SASI_Mm01_00187385 predicted 417
6 SASI_Mm01_00187386 predicted 477
7 SASI_Mm01_00187387 predicted 351
8 SASI_Mm01_00187388 predicted 962
9 SASI_Mm01_00187389 predicted 899
10 SASI_Mm01_00187390 predicted 630
11 SASI_Mm01_00187391 predicted 1025
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027129
VALIDATED
AP5S1 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 5, sigma 1 subunit
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027129.2-609s21c1
Sequence:CCGGCAGTGCTATGGCTGGGTATACCTCGAGGTATACCCAGCCATAGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027129.2-345s21c1
Sequence:CCGGTGCTCTATTCCTGTGTCTTTGCTCGAGCAAAGACACAGGAATAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366679    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027129.2-1387s21c1
Sequence:CCGGGGCCCAGGTGATGCCTTATTTCTCGAGAAATAAGGCATCACCTGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027129.2-420s21c1
Sequence:CCGGTCTTCCGCAAGGAACAGATTTCTCGAGAAATCTGTTCCTTGCGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027129.2-967s21c1
Sequence:CCGGCCACTGGAATTGTAAAGTATTCTCGAGAATACTTTACAATTCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027129.2-811s1c1
Sequence:CCGGCGAGGGTAAAGGTTGCATACTCTCGAGAGTATGCAACCTTTACCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027129.2-800s1c1
Sequence:CCGGCAGACAAAGAGCGAGGGTAAACTCGAGTTTACCCTCGCTCTTTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177799    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027129.2-1215s1c1
Sequence:CCGGCTTTGCTCATCAGCAAGGATTCTCGAGAATCCTTGCTGATGAGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027129.2-316s1c1
Sequence:CCGGGAATTTGGAAGATACAGGCCTCTCGAGAGGCCTGTATCTTCCAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027129
VALIDATED
AP5S1 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 5, sigma 1 subunit
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027129.2-609s21c1
Sequence:CCGGCAGTGCTATGGCTGGGTATACCTCGAGGTATACCCAGCCATAGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027129.2-345s21c1
Sequence:CCGGTGCTCTATTCCTGTGTCTTTGCTCGAGCAAAGACACAGGAATAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366679    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027129.2-1387s21c1
Sequence:CCGGGGCCCAGGTGATGCCTTATTTCTCGAGAAATAAGGCATCACCTGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027129.2-420s21c1
Sequence:CCGGTCTTCCGCAAGGAACAGATTTCTCGAGAAATCTGTTCCTTGCGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027129.2-967s21c1
Sequence:CCGGCCACTGGAATTGTAAAGTATTCTCGAGAATACTTTACAATTCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027129.2-811s1c1
Sequence:CCGGCGAGGGTAAAGGTTGCATACTCTCGAGAGTATGCAACCTTTACCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027129.2-800s1c1
Sequence:CCGGCAGACAAAGAGCGAGGGTAAACTCGAGTTTACCCTCGCTCTTTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177799    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027129.2-1215s1c1
Sequence:CCGGCTTTGCTCATCAGCAAGGATTCTCGAGAATCCTTGCTGATGAGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027129.2-316s1c1
Sequence:CCGGGAATTTGGAAGATACAGGCCTCTCGAGAGGCCTGTATCTTCCAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027129
VALIDATED
AP5S1 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 5, sigma 1 subunit
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027129.2-609s21c1
Sequence:CCGGCAGTGCTATGGCTGGGTATACCTCGAGGTATACCCAGCCATAGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027129.2-345s21c1
Sequence:CCGGTGCTCTATTCCTGTGTCTTTGCTCGAGCAAAGACACAGGAATAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366679    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027129.2-1387s21c1
Sequence:CCGGGGCCCAGGTGATGCCTTATTTCTCGAGAAATAAGGCATCACCTGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027129.2-420s21c1
Sequence:CCGGTCTTCCGCAAGGAACAGATTTCTCGAGAAATCTGTTCCTTGCGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027129.2-967s21c1
Sequence:CCGGCCACTGGAATTGTAAAGTATTCTCGAGAATACTTTACAATTCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027129.2-811s1c1
Sequence:CCGGCGAGGGTAAAGGTTGCATACTCTCGAGAGTATGCAACCTTTACCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027129.2-800s1c1
Sequence:CCGGCAGACAAAGAGCGAGGGTAAACTCGAGTTTACCCTCGCTCTTTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177799    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027129.2-1215s1c1
Sequence:CCGGCTTTGCTCATCAGCAAGGATTCTCGAGAATCCTTGCTGATGAGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027129.2-316s1c1
Sequence:CCGGGAATTTGGAAGATACAGGCCTCTCGAGAGGCCTGTATCTTCCAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018347
VALIDATED
AP5S1 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 5, sigma 1 subunit
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018347.1-285s21c1
Sequence:CCGGAGTGCTGTACTCCTGCGTCTTCTCGAGAAGACGCAGGAGTACAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369722    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018347.1-992s21c1
Sequence:CCGGCTGTCCTCAGGTTAGTGGAACCTCGAGGTTCCACTAACCTGAGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018347.1-461s21c1
Sequence:CCGGCGCAATCCTCAGATGAGCAAGCTCGAGCTTGCTCATCTGAGGATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018347.1-260s21c1
Sequence:CCGGATACTGAGGACACGGGCCTTTCTCGAGAAAGGCCCGTGTCCTCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018347.1-393s21c1
Sequence:CCGGCAGGCAGGTAGAGTCAATGTGCTCGAGCACATTGACTCTACCTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364898    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018347.1-1031s21c1
Sequence:CCGGTAGAGCTGCTGTGTTACTTAGCTCGAGCTAAGTAACACAGCAGCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166129    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018347.1-1616s1c1
Sequence:CCGGCCGCTGAGTTCAGAAATGCATCTCGAGATGCATTTCTGAACTCAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165213    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018347.1-1355s1c1
Sequence:CCGGGCTGAGTCATGGGAATCACTTCTCGAGAAGTGATTCCCATGACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160819    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018347.1-1570s1c1
Sequence:CCGGCCACTTAGGCAGTATTATCAACTCGAGTTGATAATACTGCCTAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162776    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018347.1-1475s1c1
Sequence:CCGGCCACAGTCATCGAAACACAAACTCGAGTTTGTGTTTCGATGACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163310    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018347.1-1002s1c1
Sequence:CCGGGTTAGTGGAACCACAGAACTTCTCGAGAAGTTCTGTGGTTCCACTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018347.1-763s1c1
Sequence:CCGGCTCAACGACCAGTTTGTCCAACTCGAGTTGGACAAACTGGTCGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018347
VALIDATED
AP5S1 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 5, sigma 1 subunit
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018347.1-285s21c1
Sequence:CCGGAGTGCTGTACTCCTGCGTCTTCTCGAGAAGACGCAGGAGTACAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369722    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018347.1-992s21c1
Sequence:CCGGCTGTCCTCAGGTTAGTGGAACCTCGAGGTTCCACTAACCTGAGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018347.1-461s21c1
Sequence:CCGGCGCAATCCTCAGATGAGCAAGCTCGAGCTTGCTCATCTGAGGATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018347.1-260s21c1
Sequence:CCGGATACTGAGGACACGGGCCTTTCTCGAGAAAGGCCCGTGTCCTCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018347.1-393s21c1
Sequence:CCGGCAGGCAGGTAGAGTCAATGTGCTCGAGCACATTGACTCTACCTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364898    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018347.1-1031s21c1
Sequence:CCGGTAGAGCTGCTGTGTTACTTAGCTCGAGCTAAGTAACACAGCAGCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166129    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018347.1-1616s1c1
Sequence:CCGGCCGCTGAGTTCAGAAATGCATCTCGAGATGCATTTCTGAACTCAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165213    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018347.1-1355s1c1
Sequence:CCGGGCTGAGTCATGGGAATCACTTCTCGAGAAGTGATTCCCATGACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160819    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018347.1-1570s1c1
Sequence:CCGGCCACTTAGGCAGTATTATCAACTCGAGTTGATAATACTGCCTAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162776    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018347.1-1475s1c1
Sequence:CCGGCCACAGTCATCGAAACACAAACTCGAGTTTGTGTTTCGATGACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163310    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018347.1-1002s1c1
Sequence:CCGGGTTAGTGGAACCACAGAACTTCTCGAGAAGTTCTGTGGTTCCACTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018347.1-763s1c1
Sequence:CCGGCTCAACGACCAGTTTGTCCAACTCGAGTTGGACAAACTGGTCGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018347
VALIDATED
AP5S1 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 5, sigma 1 subunit
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018347.1-285s21c1
Sequence:CCGGAGTGCTGTACTCCTGCGTCTTCTCGAGAAGACGCAGGAGTACAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369722    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018347.1-992s21c1
Sequence:CCGGCTGTCCTCAGGTTAGTGGAACCTCGAGGTTCCACTAACCTGAGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018347.1-461s21c1
Sequence:CCGGCGCAATCCTCAGATGAGCAAGCTCGAGCTTGCTCATCTGAGGATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018347.1-260s21c1
Sequence:CCGGATACTGAGGACACGGGCCTTTCTCGAGAAAGGCCCGTGTCCTCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018347.1-393s21c1
Sequence:CCGGCAGGCAGGTAGAGTCAATGTGCTCGAGCACATTGACTCTACCTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364898    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_018347.1-1031s21c1
Sequence:CCGGTAGAGCTGCTGTGTTACTTAGCTCGAGCTAAGTAACACAGCAGCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166129    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018347.1-1616s1c1
Sequence:CCGGCCGCTGAGTTCAGAAATGCATCTCGAGATGCATTTCTGAACTCAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165213    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018347.1-1355s1c1
Sequence:CCGGGCTGAGTCATGGGAATCACTTCTCGAGAAGTGATTCCCATGACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160819    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018347.1-1570s1c1
Sequence:CCGGCCACTTAGGCAGTATTATCAACTCGAGTTGATAATACTGCCTAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162776    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018347.1-1475s1c1
Sequence:CCGGCCACAGTCATCGAAACACAAACTCGAGTTTGTGTTTCGATGACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163310    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018347.1-1002s1c1
Sequence:CCGGGTTAGTGGAACCACAGAACTTCTCGAGAAGTTCTGTGGTTCCACTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018347.1-763s1c1
Sequence:CCGGCTCAACGACCAGTTTGTCCAACTCGAGTTGGACAAACTGGTCGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks