EMAIL THIS PAGE TO A FRIEND

AP5Z1

adaptor-related protein complex 5, zeta 1 subunit

107 Gene Product Result for
Synonyms: KIAA0415 SPG48 zeta
UniProtKB ID: O43299, Q8N3X2, Q96H80
Gene ID:
Human(9907) Summary: This gene was identified by genome-wide screen for genes involved in homologous recombination DNA double-strand break repair (HR-DSBR). The encoded protein was found in a complex with other proteins that have a role in HR-DSBR. Knockdown of this gene reduced homologous recombination, and mutations in this gene were found in patients with spastic paraplegia. It was concluded that this gene likely encodes a helicase (PMID:20613862). [provided by RefSeq, Jan 2011]
Mouse(231855) adaptor-related protein complex 5, zeta 1 subunit
Rat(641386) adaptor-related protein complex 5, zeta 1 subunit
chicken(416478) adaptor-related protein complex 5, zeta 1 subunit
domestic cat(101094558) adaptor-related protein complex 5, zeta 1 subunit
dog(609375) adaptor-related protein complex 5, zeta 1 subunit
sheep(101110022) adaptor-related protein complex 5, zeta 1 subunit
domestic guinea pig(100731381) adaptor-related protein complex 5, zeta 1 subunit
naked mole-rat(101724730) adaptor-related protein complex 5, zeta 1 subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_166527 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_166527 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_166527 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172725 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172725 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172725 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014855 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014855 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014855 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU141251 MISSION® esiRNA esiRNA human KIAA0415 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014855 Rosetta Predictions human pricing
XM_926955 Rosetta Predictions human pricing
XM_931721 Rosetta Predictions human pricing
XM_931727 Rosetta Predictions human pricing
XM_931735 Rosetta Predictions human pricing
XM_931739 Rosetta Predictions human pricing
XM_931744 Rosetta Predictions human pricing
NM_001037220 Rosetta Predictions rat pricing
NM_172725 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014855 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023866 predicted 654
2 SASI_Hs01_00023868 predicted 2375
3 SASI_Hs01_00023869 predicted 2410
4 SASI_Hs01_00023870 predicted 226
5 SASI_Hs01_00023871 predicted 1241
6 SASI_Hs01_00023872 predicted 2412
7 SASI_Hs01_00023873 predicted 1892
8 SASI_Hs01_00023874 predicted 1764
9 SASI_Hs01_00023875 predicted 401
10 SASI_Hs02_00346424 predicted 1667
11 SASI_Hs01_00023867 predicted 1115
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_926955 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00253967 predicted 661
2 SASI_Hs01_00253968 predicted 1323
3 SASI_Hs01_00253969 predicted 2236
4 SASI_Hs01_00253970 predicted 2378
5 SASI_Hs01_00253971 predicted 2413
6 SASI_Hs01_00253972 predicted 994
7 SASI_Hs01_00253973 predicted 1248
8 SASI_Hs01_00253974 predicted 2521
9 SASI_Hs01_00253975 predicted 739
10 SASI_Hs01_00253976 predicted 2186
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931721 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00291082 predicted 217
2 SASI_Hs01_00291083 predicted 216
3 SASI_Hs01_00291084 predicted 301
4 SASI_Hs01_00291085 predicted 226
5 SASI_Hs01_00291086 predicted 222
6 SASI_Hs01_00291087 predicted 209
7 SASI_Hs01_00291088 predicted 304
8 SASI_Hs01_00291089 predicted 292
9 SASI_Hs01_00291090 predicted 217
10 SASI_Hs01_00291091 predicted 598
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931727 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00291056 predicted 1696
2 SASI_Hs01_00291057 predicted 1836
3 SASI_Hs01_00291058 predicted 1872
4 SASI_Hs01_00291059 predicted 1696
5 SASI_Hs01_00291060 predicted 1876
6 SASI_Hs01_00291061 predicted 1983
7 SASI_Hs01_00291062 predicted 1983
8 SASI_Hs01_00291063 predicted 1881
9 SASI_Hs01_00291064 predicted 1694
10 SASI_Hs01_00291065 predicted 1635
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931735 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00253867 predicted 328
2 SASI_Hs01_00253868 predicted 995
3 SASI_Hs01_00253869 predicted 788
4 SASI_Hs01_00253870 predicted 658
5 SASI_Hs01_00253871 predicted 914
6 SASI_Hs01_00253872 predicted 932
7 SASI_Hs01_00253873 predicted 410
8 SASI_Hs01_00253874 predicted 899
9 SASI_Hs01_00253875 predicted 1056
10 SASI_Hs01_00253876 predicted 537
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931739 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00282646 predicted 662
2 SASI_Hs01_00282647 predicted 1323
3 SASI_Hs01_00282648 predicted 2237
4 SASI_Hs01_00282649 predicted 2280
5 SASI_Hs01_00282650 predicted 988
6 SASI_Hs01_00282651 predicted 1244
7 SASI_Hs01_00282652 predicted 2276
8 SASI_Hs01_00282653 predicted 2384
9 SASI_Hs01_00282654 predicted 2382
10 SASI_Hs01_00282655 predicted 747
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931744 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00260397 predicted 330
2 SASI_Hs01_00260398 predicted 997
3 SASI_Hs01_00260399 predicted 1903
4 SASI_Hs01_00260400 predicted 2044
5 SASI_Hs01_00260401 predicted 2084
6 SASI_Hs01_00260402 predicted 655
7 SASI_Hs01_00260403 predicted 917
8 SASI_Hs01_00260404 predicted 2188
9 SASI_Hs01_00260405 predicted 406
10 SASI_Hs01_00260406 predicted 1845
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037220 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045220 predicted 704
2 SASI_Rn01_00045221 predicted 1022
3 SASI_Rn01_00045222 predicted 2482
4 SASI_Rn01_00045224 predicted 2344
5 SASI_Rn01_00045225 predicted 303
6 SASI_Rn02_00204352 predicted 297
7 SASI_Rn02_00204353 predicted 2704
8 SASI_Rn02_00204354 predicted 704
9 SASI_Rn01_00045229 predicted 431
10 SASI_Rn02_00204355 predicted 2662
11 SASI_Rn01_00045223 predicted 1882
12 SASI_Rn01_00045226 predicted 859
13 SASI_Rn01_00045227 predicted 1726
14 SASI_Rn01_00045228 predicted 2154
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172725 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090222 predicted 2416
2 SASI_Mm01_00090223 predicted 230
3 SASI_Mm01_00090224 predicted 420
4 SASI_Mm01_00090225 predicted 815
5 SASI_Mm01_00090226 predicted 487
6 SASI_Mm01_00090227 predicted 559
7 SASI_Mm01_00090229 predicted 2376
8 SASI_Mm02_00344529 predicted 1114
9 SASI_Mm01_00090231 predicted 547
10 SASI_Mm02_00344530 predicted 1411
11 SASI_Mm01_00090228 predicted 1773
12 SASI_Mm01_00090230 predicted 2085
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_166527
VALIDATED
AP5Z1 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 5, zeta 1 subunit
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000020690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166527.6-3039s1c1
Sequence:CCGGGCGCCTCATTGAGCAAAGTAACTCGAGTTACTTTGCTCAATGAGGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_166527.6-1936s1c1
Sequence:CCGGCCCGAATTGAGTCGTTTCTATCTCGAGATAGAAACGACTCAATTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166527.6-277s1c1
Sequence:CCGGCCAGTGACCTACAAGTTACAACTCGAGTTGTAACTTGTAGGTCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166527.6-4122s1c1
Sequence:CCGGCGTGGAGCAGATCAACAAGTTCTCGAGAACTTGTTGATCTGCTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_166527
VALIDATED
AP5Z1 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 5, zeta 1 subunit
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000020690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166527.6-3039s1c1
Sequence:CCGGGCGCCTCATTGAGCAAAGTAACTCGAGTTACTTTGCTCAATGAGGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_166527.6-1936s1c1
Sequence:CCGGCCCGAATTGAGTCGTTTCTATCTCGAGATAGAAACGACTCAATTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166527.6-277s1c1
Sequence:CCGGCCAGTGACCTACAAGTTACAACTCGAGTTGTAACTTGTAGGTCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166527.6-4122s1c1
Sequence:CCGGCGTGGAGCAGATCAACAAGTTCTCGAGAACTTGTTGATCTGCTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_166527
VALIDATED
AP5Z1 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 5, zeta 1 subunit
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000020690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166527.6-3039s1c1
Sequence:CCGGGCGCCTCATTGAGCAAAGTAACTCGAGTTACTTTGCTCAATGAGGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_166527.6-1936s1c1
Sequence:CCGGCCCGAATTGAGTCGTTTCTATCTCGAGATAGAAACGACTCAATTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166527.6-277s1c1
Sequence:CCGGCCAGTGACCTACAAGTTACAACTCGAGTTGTAACTTGTAGGTCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166527.6-4122s1c1
Sequence:CCGGCGTGGAGCAGATCAACAAGTTCTCGAGAACTTGTTGATCTGCTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172725
AP5Z1 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 5, zeta 1 subunit
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182310    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172725.1-2756s1c1
Sequence:CCGGGCCTGCCACCAAGTAAATCTTCTCGAGAAGATTTACTTGGTGGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172725.1-1984s1c1
Sequence:CCGGCTTACTAAAGATGCCCAGTGTCTCGAGACACTGGGCATCTTTAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172725.1-1709s1c1
Sequence:CCGGGAACAGATCAACAAGTTCTTTCTCGAGAAAGAACTTGTTGATCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172725.1-1975s1c1
Sequence:CCGGGCTGCTAACCTTACTAAAGATCTCGAGATCTTTAGTAAGGTTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177256    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172725.1-2387s1c1
Sequence:CCGGGCTGTTACTCATTTCTGGATTCTCGAGAATCCAGAAATGAGTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200422    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172725.1-2733s1c1
Sequence:CCGGGCCTTTACCTACTGAGCCATTCTCGAGAATGGCTCAGTAGGTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172725.1-938s1c1
Sequence:CCGGGAGGTCATACACTTCTGCACACTCGAGTGTGCAGAAGTGTATGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172725
AP5Z1 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 5, zeta 1 subunit
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182310    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172725.1-2756s1c1
Sequence:CCGGGCCTGCCACCAAGTAAATCTTCTCGAGAAGATTTACTTGGTGGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172725.1-1984s1c1
Sequence:CCGGCTTACTAAAGATGCCCAGTGTCTCGAGACACTGGGCATCTTTAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172725.1-1709s1c1
Sequence:CCGGGAACAGATCAACAAGTTCTTTCTCGAGAAAGAACTTGTTGATCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172725.1-1975s1c1
Sequence:CCGGGCTGCTAACCTTACTAAAGATCTCGAGATCTTTAGTAAGGTTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177256    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172725.1-2387s1c1
Sequence:CCGGGCTGTTACTCATTTCTGGATTCTCGAGAATCCAGAAATGAGTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200422    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172725.1-2733s1c1
Sequence:CCGGGCCTTTACCTACTGAGCCATTCTCGAGAATGGCTCAGTAGGTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172725.1-938s1c1
Sequence:CCGGGAGGTCATACACTTCTGCACACTCGAGTGTGCAGAAGTGTATGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172725
AP5Z1 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 5, zeta 1 subunit
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182310    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172725.1-2756s1c1
Sequence:CCGGGCCTGCCACCAAGTAAATCTTCTCGAGAAGATTTACTTGGTGGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172725.1-1984s1c1
Sequence:CCGGCTTACTAAAGATGCCCAGTGTCTCGAGACACTGGGCATCTTTAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172725.1-1709s1c1
Sequence:CCGGGAACAGATCAACAAGTTCTTTCTCGAGAAAGAACTTGTTGATCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172725.1-1975s1c1
Sequence:CCGGGCTGCTAACCTTACTAAAGATCTCGAGATCTTTAGTAAGGTTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177256    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172725.1-2387s1c1
Sequence:CCGGGCTGTTACTCATTTCTGGATTCTCGAGAATCCAGAAATGAGTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200422    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172725.1-2733s1c1
Sequence:CCGGGCCTTTACCTACTGAGCCATTCTCGAGAATGGCTCAGTAGGTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172725.1-938s1c1
Sequence:CCGGGAGGTCATACACTTCTGCACACTCGAGTGTGCAGAAGTGTATGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014855
AP5Z1 MISSION shRNA Bacterial Glycerol Stock
adaptor-related protein complex 5, zeta 1 subunit
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014855.1-1359s21c1
Sequence:CCGGAGCACCCTCAGATTGAGCTTCCTCGAGGAAGCTCAATCTGAGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014855.1-2238s21c1
Sequence:CCGGGCCTCTTTATTGCTGTCAAAGCTCGAGCTTTGACAGCAATAAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014855.1-153s21c1
Sequence:CCGGTTCTGTTCCCGGATCTGTAAACTCGAGTTTACAGATCCGGGAACAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256547    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014855.1-2521s21c1
Sequence:CCGGAGGGACTTCGGTGCAGATTAACTCGAGTTAATCTGCACCGAAGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014855.1-234s21c1
Sequence:CCGGATCATCTCAGCCACGAAGTACCTCGAGGTACTTCGTGGCTGAGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014855
AP5Z1 MISSION shRNA shRNA Plasmid DNA
adaptor-related protein complex 5, zeta 1 subunit
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014855.1-1359s21c1
Sequence:CCGGAGCACCCTCAGATTGAGCTTCCTCGAGGAAGCTCAATCTGAGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014855.1-2238s21c1
Sequence:CCGGGCCTCTTTATTGCTGTCAAAGCTCGAGCTTTGACAGCAATAAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014855.1-153s21c1
Sequence:CCGGTTCTGTTCCCGGATCTGTAAACTCGAGTTTACAGATCCGGGAACAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256547    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014855.1-2521s21c1
Sequence:CCGGAGGGACTTCGGTGCAGATTAACTCGAGTTAATCTGCACCGAAGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014855.1-234s21c1
Sequence:CCGGATCATCTCAGCCACGAAGTACCTCGAGGTACTTCGTGGCTGAGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014855
AP5Z1 MISSION shRNA Lentiviral Transduction Particles
adaptor-related protein complex 5, zeta 1 subunit
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014855.1-1359s21c1
Sequence:CCGGAGCACCCTCAGATTGAGCTTCCTCGAGGAAGCTCAATCTGAGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014855.1-2238s21c1
Sequence:CCGGGCCTCTTTATTGCTGTCAAAGCTCGAGCTTTGACAGCAATAAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014855.1-153s21c1
Sequence:CCGGTTCTGTTCCCGGATCTGTAAACTCGAGTTTACAGATCCGGGAACAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256547    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014855.1-2521s21c1
Sequence:CCGGAGGGACTTCGGTGCAGATTAACTCGAGTTAATCTGCACCGAAGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014855.1-234s21c1
Sequence:CCGGATCATCTCAGCCACGAAGTACCTCGAGGTACTTCGTGGCTGAGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks