EMAIL THIS PAGE TO A FRIEND

APAF1

apoptotic peptidase activating factor 1

164 Gene Product Result for
Synonyms: APAF-1 CED4
Gene ID:
Human(317) Summary: This gene encodes a cytoplasmic protein that initiates apoptosis. This protein contains several copies of the WD-40 domain, a caspase recruitment domain (CARD), and an ATPase domain (NB-ARC). Upon binding cytochrome c and dATP, this protein forms an oligomeric apoptosome. The apoptosome binds and cleaves caspase 9 preproprotein, releasing its mature, activated form. Activated caspase 9 stimulates the subsequent caspase cascade that commits the cell to apoptosis. Alternative splicing results in several transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(11783) apoptotic peptidase activating factor 1
Rat(78963) apoptotic peptidase activating factor 1
Zebrafish(58131) apoptotic protease activating factor 1
cow(537782) apoptotic peptidase activating factor 1
Horse(100052552) apoptotic peptidase activating factor 1
domestic cat(768257) apoptotic peptidase activating factor 1
dog(482620) apoptotic peptidase activating factor 1
chicken(417926) apoptotic peptidase activating factor 1
naked mole-rat(101706721) apoptotic peptidase activating factor 1
domestic guinea pig(100719903) apoptotic peptidase activating factor 1
sheep(100135699) apoptotic peptidase activating factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009684 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009684 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009684 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001160 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001160 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001160 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001160 Rosetta Predictions human pricing
NM_013229 Rosetta Predictions human pricing
NM_181861 Rosetta Predictions human pricing
NM_181868 Rosetta Predictions human pricing
NM_181869 Rosetta Predictions human pricing
NM_023979 Rosetta Predictions rat pricing
NM_001042558 Rosetta Predictions mouse pricing
NM_009684 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001160 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331274 predicted 4370
2 SASI_Hs02_00331275 predicted 4285
3 SASI_Hs01_00235892 predicted 641
4 SASI_Hs01_00235893 predicted 1227
5 SASI_Hs01_00235894 predicted 643
6 SASI_Hs01_00235895 predicted 633
7 SASI_Hs02_00331276 predicted 1253
8 SASI_Hs01_00235896 predicted 631
9 SASI_Hs01_00235897 predicted 1153
10 SASI_Hs01_00235898 predicted 4247
11 SASI_Hs01_00235891 predicted 4370
12 SASI_Hs01_00235899 predicted 1195
13 SASI_Hs01_00235900 predicted 596
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013229 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344411 predicted 4506
2 SASI_Hs02_00344412 predicted 4413
3 SASI_Hs01_00173917 predicted 642
4 SASI_Hs01_00173918 predicted 1221
5 SASI_Hs01_00173919 predicted 648
6 SASI_Hs01_00173920 predicted 633
7 SASI_Hs02_00344413 predicted 1251
8 SASI_Hs01_00173921 predicted 628
9 SASI_Hs01_00173922 predicted 1157
10 SASI_Hs01_00173923 predicted 4376
11 SASI_Hs01_00173916 predicted 4492
12 SASI_Hs01_00173924 predicted 1192
13 SASI_Hs01_00173925 predicted 588
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181861 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370446 predicted 4540
2 SASI_Hs02_00370447 predicted 4441
3 SASI_Hs01_00124090 predicted 639
4 SASI_Hs01_00124091 predicted 1251
5 SASI_Hs01_00124092 predicted 643
6 SASI_Hs01_00124093 predicted 637
7 SASI_Hs02_00370448 predicted 1288
8 SASI_Hs01_00124094 predicted 629
9 SASI_Hs01_00124095 predicted 1190
10 SASI_Hs01_00124096 predicted 4408
11 SASI_Hs01_00124089 predicted 4527
12 SASI_Hs01_00124097 predicted 1225
13 SASI_Hs01_00124098 predicted 594
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181868 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370461 predicted 4408
2 SASI_Hs02_00370462 predicted 4318
3 SASI_Hs01_00201798 predicted 635
4 SASI_Hs01_00201799 predicted 1256
5 SASI_Hs01_00201800 predicted 645
6 SASI_Hs01_00201801 predicted 639
7 SASI_Hs02_00370463 predicted 1282
8 SASI_Hs01_00201802 predicted 624
9 SASI_Hs01_00201803 predicted 1186
10 SASI_Hs01_00201804 predicted 4284
11 SASI_Hs01_00201797 predicted 4402
12 SASI_Hs01_00201805 predicted 1224
13 SASI_Hs01_00201806 predicted 590
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181869 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180579 predicted 1891
2 SASI_Hs01_00180580 predicted 1803
3 SASI_Hs01_00180581 predicted 640
4 SASI_Hs01_00180582 predicted 1253
5 SASI_Hs02_00370464 predicted 640
6 SASI_Hs02_00370465 predicted 638
7 SASI_Hs02_00370466 predicted 1280
8 SASI_Hs01_00180583 predicted 623
9 SASI_Hs01_00180584 predicted 1185
10 SASI_Hs01_00180585 predicted 1764
11 SASI_Hs01_00180577 predicted 1936
12 SASI_Hs01_00180578 predicted 1887
13 SASI_Hs01_00180586 predicted 1234
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023979 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263801 predicted 1871
2 SASI_Rn01_00116909 predicted 2785
3 SASI_Rn01_00116910 predicted 1410
4 SASI_Rn01_00116911 predicted 676
5 SASI_Rn01_00116912 predicted 2371
6 SASI_Rn01_00116913 predicted 1878
7 SASI_Rn01_00116914 predicted 2715
8 SASI_Rn01_00116915 predicted 837
9 SASI_Rn01_00116918 predicted 2104
10 SASI_Rn02_00263802 predicted 3178
11 SASI_Rn01_00116916 predicted 705
12 SASI_Rn01_00116917 predicted 2600
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042558 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290605 predicted 1930
2 SASI_Mm02_00290606 predicted 1920
3 SASI_Mm02_00290607 predicted 3740
4 SASI_Mm02_00290608 predicted 1167
5 SASI_Mm02_00290609 predicted 1755
6 SASI_Mm02_00290610 predicted 2154
7 SASI_Mm02_00290611 predicted 848
8 SASI_Mm02_00290612 predicted 2698
9 SASI_Mm02_00290613 predicted 1447
10 SASI_Mm02_00290614 predicted 1768
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009684 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029020 predicted 1888
2 SASI_Mm01_00029021 predicted 1878
3 SASI_Mm01_00029023 predicted 3690
4 SASI_Mm01_00029024 predicted 1121
5 SASI_Mm01_00029025 predicted 1710
6 SASI_Mm01_00029026 predicted 2112
7 SASI_Mm02_00316765 predicted 814
8 SASI_Mm01_00029029 predicted 2648
9 SASI_Mm02_00316766 predicted 1405
10 SASI_Mm02_00316767 predicted 1725
11 SASI_Mm01_00029022 predicted 4252
12 SASI_Mm01_00029027 predicted 1332
13 SASI_Mm01_00029028 predicted 1932
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009684
APAF1 MISSION shRNA Bacterial Glycerol Stock
apoptotic peptidase activating factor 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009684.2-701s21c1
Sequence:CCGGATGGATCACATGATCAGTAATCTCGAGATTACTGATCATGTGATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009684.2-4526s21c1
Sequence:CCGGAGTTGGGTGAATCATAGTATACTCGAGTATACTATGATTCACCCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009684.1-1513s1c1
Sequence:CCGGCCTCTTGTAGTGTCTTTAATTCTCGAGAATTAAAGACACTACAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012278    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009684.1-4753s1c1
Sequence:CCGGCATGCTTATTTGCACTCTTTACTCGAGTAAAGAGTGCAAATAAGCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009684.1-2273s1c1
Sequence:CCGGCCGAAGTTTATCGACAAGCAACTCGAGTTGCTTGTCGATAAACTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009684.1-2581s1c1
Sequence:CCGGGCGGATAAGAAGGTTAAGATTCTCGAGAATCTTAACCTTCTTATCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009684
APAF1 MISSION shRNA shRNA Plasmid DNA
apoptotic peptidase activating factor 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009684.2-701s21c1
Sequence:CCGGATGGATCACATGATCAGTAATCTCGAGATTACTGATCATGTGATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009684.2-4526s21c1
Sequence:CCGGAGTTGGGTGAATCATAGTATACTCGAGTATACTATGATTCACCCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009684.1-1513s1c1
Sequence:CCGGCCTCTTGTAGTGTCTTTAATTCTCGAGAATTAAAGACACTACAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012278    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009684.1-4753s1c1
Sequence:CCGGCATGCTTATTTGCACTCTTTACTCGAGTAAAGAGTGCAAATAAGCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009684.1-2273s1c1
Sequence:CCGGCCGAAGTTTATCGACAAGCAACTCGAGTTGCTTGTCGATAAACTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009684.1-2581s1c1
Sequence:CCGGGCGGATAAGAAGGTTAAGATTCTCGAGAATCTTAACCTTCTTATCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009684
APAF1 MISSION shRNA Lentiviral Transduction Particles
apoptotic peptidase activating factor 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009684.2-701s21c1
Sequence:CCGGATGGATCACATGATCAGTAATCTCGAGATTACTGATCATGTGATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009684.2-4526s21c1
Sequence:CCGGAGTTGGGTGAATCATAGTATACTCGAGTATACTATGATTCACCCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009684.1-1513s1c1
Sequence:CCGGCCTCTTGTAGTGTCTTTAATTCTCGAGAATTAAAGACACTACAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012278    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009684.1-4753s1c1
Sequence:CCGGCATGCTTATTTGCACTCTTTACTCGAGTAAAGAGTGCAAATAAGCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009684.1-2273s1c1
Sequence:CCGGCCGAAGTTTATCGACAAGCAACTCGAGTTGCTTGTCGATAAACTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009684.1-2581s1c1
Sequence:CCGGGCGGATAAGAAGGTTAAGATTCTCGAGAATCTTAACCTTCTTATCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001160
VALIDATED
APAF1 MISSION shRNA Bacterial Glycerol Stock
apoptotic peptidase activating factor 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000314805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160.2-3452s21c1
Sequence:CCGGGCCGATGAGAAGACTCTTATTCTCGAGAATAAGAGTCTTCTCATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160.2-1643s21c1
Sequence:CCGGGCCATGTCTATAAGTGTTGAACTCGAGTTCAACACTTATAGACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160.2-3225s21c1
Sequence:CCGGTCCTTGCAGTTGACCATATAACTCGAGTTATATGGTCAACTGCAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369079    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001160.2-4327s21c1
Sequence:CCGGTCCCAAATGAACATACCTTTACTCGAGTAAAGGTATGTTCATTTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160.2-3991s21c1
Sequence:CCGGTATCTCTGCTGGAGGATATATCTCGAGATATATCCTCCAGCAGAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001160.2-1643s1c1
Sequence:CCGGGCCATGTCTATAAGTGTTGAACTCGAGTTCAACACTTATAGACATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001160.2-1141s1c1
Sequence:CCGGGCAGAATCTTTGCACACGGTTCTCGAGAACCGTGTGCAAAGATTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001160.2-2254s1c1
Sequence:CCGGGCCGGAAACTTCAGAAGTTTACTCGAGTAAACTTCTGAAGTTTCCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001160.2-3452s1c1
Sequence:CCGGGCCGATGAGAAGACTCTTATTCTCGAGAATAAGAGTCTTCTCATCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006695    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001160.2-5687s1c1
Sequence:CCGGGCATTGTGAATGCCATTCTTTCTCGAGAAAGAATGGCATTCACAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001160
VALIDATED
APAF1 MISSION shRNA shRNA Plasmid DNA
apoptotic peptidase activating factor 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000314805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160.2-3452s21c1
Sequence:CCGGGCCGATGAGAAGACTCTTATTCTCGAGAATAAGAGTCTTCTCATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160.2-1643s21c1
Sequence:CCGGGCCATGTCTATAAGTGTTGAACTCGAGTTCAACACTTATAGACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160.2-3225s21c1
Sequence:CCGGTCCTTGCAGTTGACCATATAACTCGAGTTATATGGTCAACTGCAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369079    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001160.2-4327s21c1
Sequence:CCGGTCCCAAATGAACATACCTTTACTCGAGTAAAGGTATGTTCATTTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160.2-3991s21c1
Sequence:CCGGTATCTCTGCTGGAGGATATATCTCGAGATATATCCTCCAGCAGAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001160.2-1643s1c1
Sequence:CCGGGCCATGTCTATAAGTGTTGAACTCGAGTTCAACACTTATAGACATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001160.2-1141s1c1
Sequence:CCGGGCAGAATCTTTGCACACGGTTCTCGAGAACCGTGTGCAAAGATTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001160.2-2254s1c1
Sequence:CCGGGCCGGAAACTTCAGAAGTTTACTCGAGTAAACTTCTGAAGTTTCCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001160.2-3452s1c1
Sequence:CCGGGCCGATGAGAAGACTCTTATTCTCGAGAATAAGAGTCTTCTCATCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006695    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001160.2-5687s1c1
Sequence:CCGGGCATTGTGAATGCCATTCTTTCTCGAGAAAGAATGGCATTCACAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001160
VALIDATED
APAF1 MISSION shRNA Lentiviral Transduction Particles
apoptotic peptidase activating factor 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000314805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160.2-3452s21c1
Sequence:CCGGGCCGATGAGAAGACTCTTATTCTCGAGAATAAGAGTCTTCTCATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160.2-1643s21c1
Sequence:CCGGGCCATGTCTATAAGTGTTGAACTCGAGTTCAACACTTATAGACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160.2-3225s21c1
Sequence:CCGGTCCTTGCAGTTGACCATATAACTCGAGTTATATGGTCAACTGCAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369079    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001160.2-4327s21c1
Sequence:CCGGTCCCAAATGAACATACCTTTACTCGAGTAAAGGTATGTTCATTTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001160.2-3991s21c1
Sequence:CCGGTATCTCTGCTGGAGGATATATCTCGAGATATATCCTCCAGCAGAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001160.2-1643s1c1
Sequence:CCGGGCCATGTCTATAAGTGTTGAACTCGAGTTCAACACTTATAGACATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001160.2-1141s1c1
Sequence:CCGGGCAGAATCTTTGCACACGGTTCTCGAGAACCGTGTGCAAAGATTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001160.2-2254s1c1
Sequence:CCGGGCCGGAAACTTCAGAAGTTTACTCGAGTAAACTTCTGAAGTTTCCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001160.2-3452s1c1
Sequence:CCGGGCCGATGAGAAGACTCTTATTCTCGAGAATAAGAGTCTTCTCATCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006695    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001160.2-5687s1c1
Sequence:CCGGGCATTGTGAATGCCATTCTTTCTCGAGAAAGAATGGCATTCACAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks