EMAIL THIS PAGE TO A FRIEND

APBA1

amyloid beta (A4) precursor protein-binding, family A, member 1

Synonyms: D9S411E LIN10 MINT1 X11 X11A X11ALPHA
UniProtKB ID: Q02410, O14914, O60570, Q5VYR8
Gene ID:
Human(320) Summary: The protein encoded by this gene is a member of the X11 protein family. It is a neuronal adapter protein that interacts with the Alzheimer's disease amyloid precursor protein (APP). It stabilizes APP and inhibits production of proteolytic APP fragments including the A beta peptide that is deposited in the brains of Alzheimer's disease patients. This gene product is believed to be involved in signal transduction processes. It is also regarded as a putative vesicular trafficking protein in the brain that can form a complex with the potential to couple synaptic vesicle exocytosis to neuronal cell adhesion. [provided by RefSeq, Jul 2008]
Mouse(319924) amyloid beta (A4) precursor protein binding, family A, member 1
Rat(83589) amyloid beta (A4) precursor protein-binding, family A, member 1
chicken(427246) amyloid beta (A4) precursor protein-binding, family A, member 1
domestic cat(101085413) amyloid beta (A4) precursor protein-binding, family A, member 1
cow(515571) amyloid beta (A4) precursor protein-binding, family A, member 1
dog(100686233) amyloid beta (A4) precursor protein-binding, family A, member 1
sheep(101105978) amyloid beta (A4) precursor protein-binding, family A, member 1
domestic guinea pig(100724666) amyloid beta (A4) precursor protein-binding, family A, member 1
naked mole-rat(101722004) amyloid beta (A4) precursor protein-binding, family A, member 1
61 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177034 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177034 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177034 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001163 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001163 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001163 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001163 Rosetta Predictions human pricing
NM_031779 Rosetta Predictions rat pricing
NM_177034 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001163 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010791 predicted 2389
2 SASI_Hs01_00010792 predicted 2211
3 SASI_Hs01_00010793 predicted 1693
4 SASI_Hs01_00010794 predicted 2419
5 SASI_Hs01_00010795 predicted 2158
6 SASI_Hs01_00010796 predicted 2041
7 SASI_Hs01_00010797 predicted 1753
8 SASI_Hs01_00010799 predicted 1461
9 SASI_Hs01_00010800 predicted 2459
10 SASI_Hs02_00331279 predicted 1748
11 SASI_Hs01_00010798 predicted 2108
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031779 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074666 predicted 1815
2 SASI_Rn02_00265217 predicted 2309
3 SASI_Rn01_00074667 predicted 1702
4 SASI_Rn01_00074668 predicted 2389
5 SASI_Rn01_00074669 predicted 2513
6 SASI_Rn01_00074670 predicted 2367
7 SASI_Rn01_00074671 predicted 1726
8 SASI_Rn01_00074672 predicted 2000
9 SASI_Rn01_00074673 predicted 2101
10 SASI_Rn01_00074674 predicted 2303
11 SASI_Rn01_00074675 predicted 2508
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177034 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122403 predicted 2453
2 SASI_Mm01_00122404 predicted 1773
3 SASI_Mm01_00122405 predicted 2290
4 SASI_Mm01_00122406 predicted 2053
5 SASI_Mm01_00122407 predicted 1663
6 SASI_Mm01_00122408 predicted 2472
7 SASI_Mm01_00122409 predicted 2329
8 SASI_Mm01_00122410 predicted 1690
9 SASI_Mm01_00122411 predicted 1949
10 SASI_Mm01_00122412 predicted 2345
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177034
APBA1 MISSION shRNA Bacterial Glycerol Stock
amyloid beta (A4) precursor protein-binding, family A, member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093469    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177034.2-2110s1c1
Sequence:CCGGGCCCACATCTTTAAGGATGTTCTCGAGAACATCCTTAAAGATGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177034.2-346s1c1
Sequence:CCGGCCTCCACAAATAAAGAGTCAACTCGAGTTGACTCTTTATTTGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177034.2-1232s1c1
Sequence:CCGGCCAGAGCATCATTAAGGGCTTCTCGAGAAGCCCTTAATGATGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177034.2-1422s1c1
Sequence:CCGGCATCGGATCATCGAAATCAATCTCGAGATTGATTTCGATGATCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177034.2-1235s1c1
Sequence:CCGGGAGCATCATTAAGGGCTTAAACTCGAGTTTAAGCCCTTAATGATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177034
APBA1 MISSION shRNA shRNA Plasmid DNA
amyloid beta (A4) precursor protein-binding, family A, member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093469    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177034.2-2110s1c1
Sequence:CCGGGCCCACATCTTTAAGGATGTTCTCGAGAACATCCTTAAAGATGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177034.2-346s1c1
Sequence:CCGGCCTCCACAAATAAAGAGTCAACTCGAGTTGACTCTTTATTTGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177034.2-1232s1c1
Sequence:CCGGCCAGAGCATCATTAAGGGCTTCTCGAGAAGCCCTTAATGATGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177034.2-1422s1c1
Sequence:CCGGCATCGGATCATCGAAATCAATCTCGAGATTGATTTCGATGATCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177034.2-1235s1c1
Sequence:CCGGGAGCATCATTAAGGGCTTAAACTCGAGTTTAAGCCCTTAATGATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177034
APBA1 MISSION shRNA Lentiviral Transduction Particles
amyloid beta (A4) precursor protein-binding, family A, member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093469    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177034.2-2110s1c1
Sequence:CCGGGCCCACATCTTTAAGGATGTTCTCGAGAACATCCTTAAAGATGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177034.2-346s1c1
Sequence:CCGGCCTCCACAAATAAAGAGTCAACTCGAGTTGACTCTTTATTTGTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177034.2-1232s1c1
Sequence:CCGGCCAGAGCATCATTAAGGGCTTCTCGAGAAGCCCTTAATGATGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177034.2-1422s1c1
Sequence:CCGGCATCGGATCATCGAAATCAATCTCGAGATTGATTTCGATGATCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177034.2-1235s1c1
Sequence:CCGGGAGCATCATTAAGGGCTTAAACTCGAGTTTAAGCCCTTAATGATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001163
APBA1 MISSION shRNA Bacterial Glycerol Stock
amyloid beta (A4) precursor protein-binding, family A, member 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001163.2-3275s1c1
Sequence:CCGGCCAACCTTAAACCTCTTCTATCTCGAGATAGAAGAGGTTTAAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001163.2-2038s1c1
Sequence:CCGGACAGGCATTTAGCGTGGCATACTCGAGTATGCCACGCTAAATGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001163.2-1506s1c1
Sequence:CCGGCCACTAATAAAGAGTCAAGAACTCGAGTTCTTGACTCTTTATTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001163.2-2578s1c1
Sequence:CCGGGCACCGGATCATTGAAATCAACTCGAGTTGATTTCAATGATCCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001163.2-2389s1c1
Sequence:CCGGCCAGAGCATTATTAAGGGCTTCTCGAGAAGCCCTTAATAATGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001163
APBA1 MISSION shRNA shRNA Plasmid DNA
amyloid beta (A4) precursor protein-binding, family A, member 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001163.2-3275s1c1
Sequence:CCGGCCAACCTTAAACCTCTTCTATCTCGAGATAGAAGAGGTTTAAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001163.2-2038s1c1
Sequence:CCGGACAGGCATTTAGCGTGGCATACTCGAGTATGCCACGCTAAATGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001163.2-1506s1c1
Sequence:CCGGCCACTAATAAAGAGTCAAGAACTCGAGTTCTTGACTCTTTATTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001163.2-2578s1c1
Sequence:CCGGGCACCGGATCATTGAAATCAACTCGAGTTGATTTCAATGATCCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001163.2-2389s1c1
Sequence:CCGGCCAGAGCATTATTAAGGGCTTCTCGAGAAGCCCTTAATAATGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001163
APBA1 MISSION shRNA Lentiviral Transduction Particles
amyloid beta (A4) precursor protein-binding, family A, member 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001163.2-3275s1c1
Sequence:CCGGCCAACCTTAAACCTCTTCTATCTCGAGATAGAAGAGGTTTAAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001163.2-2038s1c1
Sequence:CCGGACAGGCATTTAGCGTGGCATACTCGAGTATGCCACGCTAAATGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001163.2-1506s1c1
Sequence:CCGGCCACTAATAAAGAGTCAAGAACTCGAGTTCTTGACTCTTTATTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001163.2-2578s1c1
Sequence:CCGGGCACCGGATCATTGAAATCAACTCGAGTTGATTTCAATGATCCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001163.2-2389s1c1
Sequence:CCGGCCAGAGCATTATTAAGGGCTTCTCGAGAAGCCCTTAATAATGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks