EMAIL THIS PAGE TO A FRIEND

APBA2

amyloid beta (A4) precursor protein-binding, family A, member 2

69 Gene Product Result for
Synonyms: D15S1518E HsT16821 LIN-10 MGC:14091 MINT2 X11-BETA X11L
UniProtKB ID: Q99767, E9PGI4, O60571, Q5XKC0
Gene ID:
Human(321) Summary: The protein encoded by this gene is a member of the X11 protein family. It is a neuronal adapter protein that interacts with the Alzheimer's disease amyloid precursor protein (APP). It stabilizes APP and inhibits production of proteolytic APP fragments including the A beta peptide that is deposited in the brains of Alzheimer's disease patients. This gene product is believed to be involved in signal transduction processes. It is also regarded as a putative vesicular trafficking protein in the brain that can form a complex with the potential to couple synaptic vesicle exocytosis to neuronal cell adhesion. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(11784) amyloid beta (A4) precursor protein-binding, family A, member 2
Rat(83610) amyloid beta (A4) precursor protein-binding, family A, member 2
chicken(415386) amyloid beta (A4) precursor protein-binding, family A, member 2
dog(488700) amyloid beta (A4) precursor protein-binding, family A, member 2
Horse(100059336) amyloid beta (A4) precursor protein-binding, family A, member 2
cow(514762) amyloid beta (A4) precursor protein-binding, family A, member 2
domestic cat(101082494) amyloid beta (A4) precursor protein-binding, family A, member 2
naked mole-rat(101725293) amyloid beta (A4) precursor protein-binding, family A, member 2
domestic guinea pig(100715160) amyloid beta (A4) precursor protein-binding, family A, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005503 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005503 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005503 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007461 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007461 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007461 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005503 Rosetta Predictions human pricing
NM_031780 Rosetta Predictions rat pricing
NM_007461 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005503 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339706 predicted 1297
2 SASI_Hs01_00100181 predicted 1187
3 SASI_Hs02_00339707 predicted 1300
4 SASI_Hs01_00100183 predicted 1184
5 SASI_Hs01_00100184 predicted 742
6 SASI_Hs01_00100185 predicted 2613
7 SASI_Hs01_00100186 predicted 884
8 SASI_Hs01_00100188 predicted 1733
9 SASI_Hs01_00100189 predicted 2638
10 SASI_Hs01_00100190 predicted 224
11 SASI_Hs01_00100182 predicted 1231
12 SASI_Hs01_00100187 predicted 1228
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031780 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080681 predicted 2019
2 SASI_Rn01_00080682 predicted 319
3 SASI_Rn01_00080683 predicted 1517
4 SASI_Rn02_00265218 predicted 1238
5 SASI_Rn01_00080684 predicted 1906
6 SASI_Rn01_00080685 predicted 1861
7 SASI_Rn01_00080686 predicted 956
8 SASI_Rn01_00080688 predicted 1870
9 SASI_Rn01_00080689 predicted 931
10 SASI_Rn01_00080690 predicted 1770
11 SASI_Rn01_00080687 predicted 540
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007461 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025490 predicted 1950
2 SASI_Mm01_00025491 predicted 1359
3 SASI_Mm01_00025492 predicted 2108
4 SASI_Mm01_00025493 predicted 1322
5 SASI_Mm01_00025494 predicted 1359
6 SASI_Mm01_00025495 predicted 1440
7 SASI_Mm01_00025496 predicted 1609
8 SASI_Mm02_00311652 predicted 1621
9 SASI_Mm02_00311653 predicted 1358
10 SASI_Mm01_00025499 predicted 1512
11 SASI_Mm01_00025497 predicted 1818
12 SASI_Mm01_00025498 predicted 1437
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005503
VALIDATED
APBA2 MISSION shRNA Bacterial Glycerol Stock
amyloid beta (A4) precursor protein-binding, family A, member 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005503.2-1868s1c1
Sequence:CCGGCCACTTCTCAAACTCGGAGAACTCGAGTTCTCCGAGTTTGAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005503.2-570s1c1
Sequence:CCGGGCACACCCTGTGGACACTGATCTCGAGATCAGTGTCCACAGGGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005503.2-1185s1c1
Sequence:CCGGTCTGATCTCAATGGACCTGTTCTCGAGAACAGGTCCATTGAGATCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005503.2-1399s1c1
Sequence:CCGGGCCGGGTCAAGAGGATGCAAACTCGAGTTTGCATCCTCTTGACCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005503.2-1811s1c1
Sequence:CCGGCCAGAAGGAATACAGCGACATCTCGAGATGTCGCTGTATTCCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005503.3-2697s21c1
Sequence:CCGGCCACGTTCTGGACTGTCTTCTCTCGAGAGAAGACAGTCCAGAACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005503.3-1304s21c1
Sequence:CCGGTCATCGACGGGATCATCTTTGCTCGAGCAAAGATGATCCCGTCGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005503.3-1848s21c1
Sequence:CCGGCAACACCCAGGAGATGTACAACTCGAGTTGTACATCTCCTGGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005503.3-2650s21c1
Sequence:CCGGAGAGTCACAGAACAAATGTTTCTCGAGAAACATTTGTTCTGTGACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005503.3-2175s21c1
Sequence:CCGGGGTCACCACGGTCCTTATCAACTCGAGTTGATAAGGACCGTGGTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005503.3-1568s21c1
Sequence:CCGGTGCGTACCATCTCCTACATCGCTCGAGCGATGTAGGAGATGGTACGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005503.3-892s21c1
Sequence:CCGCATCGTGGCAGAGATCAAGATGCTCGAGCATCTTGATCTCTGCCACGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005503.3-422s21c1
Sequence:CCGGCCAGCTCTGACTACGTGAACACTCGAGTGTTCACGTAGTCAGAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005503
VALIDATED
APBA2 MISSION shRNA shRNA Plasmid DNA
amyloid beta (A4) precursor protein-binding, family A, member 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005503.2-1868s1c1
Sequence:CCGGCCACTTCTCAAACTCGGAGAACTCGAGTTCTCCGAGTTTGAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005503.2-570s1c1
Sequence:CCGGGCACACCCTGTGGACACTGATCTCGAGATCAGTGTCCACAGGGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005503.2-1185s1c1
Sequence:CCGGTCTGATCTCAATGGACCTGTTCTCGAGAACAGGTCCATTGAGATCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005503.2-1399s1c1
Sequence:CCGGGCCGGGTCAAGAGGATGCAAACTCGAGTTTGCATCCTCTTGACCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005503.2-1811s1c1
Sequence:CCGGCCAGAAGGAATACAGCGACATCTCGAGATGTCGCTGTATTCCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005503.3-2697s21c1
Sequence:CCGGCCACGTTCTGGACTGTCTTCTCTCGAGAGAAGACAGTCCAGAACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005503.3-1304s21c1
Sequence:CCGGTCATCGACGGGATCATCTTTGCTCGAGCAAAGATGATCCCGTCGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005503.3-1848s21c1
Sequence:CCGGCAACACCCAGGAGATGTACAACTCGAGTTGTACATCTCCTGGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005503.3-2650s21c1
Sequence:CCGGAGAGTCACAGAACAAATGTTTCTCGAGAAACATTTGTTCTGTGACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005503.3-2175s21c1
Sequence:CCGGGGTCACCACGGTCCTTATCAACTCGAGTTGATAAGGACCGTGGTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005503.3-1568s21c1
Sequence:CCGGTGCGTACCATCTCCTACATCGCTCGAGCGATGTAGGAGATGGTACGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005503.3-892s21c1
Sequence:CCGCATCGTGGCAGAGATCAAGATGCTCGAGCATCTTGATCTCTGCCACGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005503.3-422s21c1
Sequence:CCGGCCAGCTCTGACTACGTGAACACTCGAGTGTTCACGTAGTCAGAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005503
VALIDATED
APBA2 MISSION shRNA Lentiviral Transduction Particles
amyloid beta (A4) precursor protein-binding, family A, member 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005503.2-1868s1c1
Sequence:CCGGCCACTTCTCAAACTCGGAGAACTCGAGTTCTCCGAGTTTGAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005503.2-570s1c1
Sequence:CCGGGCACACCCTGTGGACACTGATCTCGAGATCAGTGTCCACAGGGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005503.2-1185s1c1
Sequence:CCGGTCTGATCTCAATGGACCTGTTCTCGAGAACAGGTCCATTGAGATCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005503.2-1399s1c1
Sequence:CCGGGCCGGGTCAAGAGGATGCAAACTCGAGTTTGCATCCTCTTGACCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005503.2-1811s1c1
Sequence:CCGGCCAGAAGGAATACAGCGACATCTCGAGATGTCGCTGTATTCCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005503.3-2697s21c1
Sequence:CCGGCCACGTTCTGGACTGTCTTCTCTCGAGAGAAGACAGTCCAGAACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005503.3-1304s21c1
Sequence:CCGGTCATCGACGGGATCATCTTTGCTCGAGCAAAGATGATCCCGTCGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005503.3-1848s21c1
Sequence:CCGGCAACACCCAGGAGATGTACAACTCGAGTTGTACATCTCCTGGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005503.3-2650s21c1
Sequence:CCGGAGAGTCACAGAACAAATGTTTCTCGAGAAACATTTGTTCTGTGACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005503.3-2175s21c1
Sequence:CCGGGGTCACCACGGTCCTTATCAACTCGAGTTGATAAGGACCGTGGTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005503.3-1568s21c1
Sequence:CCGGTGCGTACCATCTCCTACATCGCTCGAGCGATGTAGGAGATGGTACGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005503.3-892s21c1
Sequence:CCGCATCGTGGCAGAGATCAAGATGCTCGAGCATCTTGATCTCTGCCACGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005503.3-422s21c1
Sequence:CCGGCCAGCTCTGACTACGTGAACACTCGAGTGTTCACGTAGTCAGAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007461
APBA2 MISSION shRNA Bacterial Glycerol Stock
amyloid beta (A4) precursor protein-binding, family A, member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093559    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007461.1-3022s1c1
Sequence:CCGGCCTGAGGCTATGGAATGTGAACTCGAGTTCACATTCCATAGCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007461.1-1955s1c1
Sequence:CCGGGAAGGAATATAGCGACATCATCTCGAGATGATGTCGCTATATTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007461.1-1952s1c1
Sequence:CCGGCCAGAAGGAATATAGCGACATCTCGAGATGTCGCTATATTCCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007461.1-1340s1c1
Sequence:CCGGGCCCACTGACAATAACAACATCTCGAGATGTTGTTATTGTCAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007461.1-1640s1c1
Sequence:CCGGCCAGAGGATCAAGGTCTTAAACTCGAGTTTAAGACCTTGATCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007461
APBA2 MISSION shRNA shRNA Plasmid DNA
amyloid beta (A4) precursor protein-binding, family A, member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093559    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007461.1-3022s1c1
Sequence:CCGGCCTGAGGCTATGGAATGTGAACTCGAGTTCACATTCCATAGCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007461.1-1955s1c1
Sequence:CCGGGAAGGAATATAGCGACATCATCTCGAGATGATGTCGCTATATTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007461.1-1952s1c1
Sequence:CCGGCCAGAAGGAATATAGCGACATCTCGAGATGTCGCTATATTCCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007461.1-1340s1c1
Sequence:CCGGGCCCACTGACAATAACAACATCTCGAGATGTTGTTATTGTCAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007461.1-1640s1c1
Sequence:CCGGCCAGAGGATCAAGGTCTTAAACTCGAGTTTAAGACCTTGATCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007461
APBA2 MISSION shRNA Lentiviral Transduction Particles
amyloid beta (A4) precursor protein-binding, family A, member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093559    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007461.1-3022s1c1
Sequence:CCGGCCTGAGGCTATGGAATGTGAACTCGAGTTCACATTCCATAGCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007461.1-1955s1c1
Sequence:CCGGGAAGGAATATAGCGACATCATCTCGAGATGATGTCGCTATATTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007461.1-1952s1c1
Sequence:CCGGCCAGAAGGAATATAGCGACATCTCGAGATGTCGCTATATTCCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007461.1-1340s1c1
Sequence:CCGGGCCCACTGACAATAACAACATCTCGAGATGTTGTTATTGTCAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007461.1-1640s1c1
Sequence:CCGGCCAGAGGATCAAGGTCTTAAACTCGAGTTTAAGACCTTGATCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks