EMAIL THIS PAGE TO A FRIEND

APBA3

amyloid beta (A4) precursor protein-binding, family A, member 3

44 Gene Product Result for
Synonyms: MGC:15815 X11L2 mint3
UniProtKB ID: O96018, O60483, Q9UPZ2
Gene ID:
Human(9546) Summary: The protein encoded by this gene is a member of the X11 protein family. It is an adapter protein that interacts with the Alzheimer's disease amyloid precursor protein. This gene product is believed to be involved in signal transduction processes. This gene is a candidate gene for Alzheimer's disease. [provided by RefSeq, Jul 2008]
Mouse(57267) amyloid beta (A4) precursor protein-binding, family A, member 3
Rat(83611) amyloid beta (A4) precursor protein-binding, family A, member 3
chicken(420069) amyloid beta (A4) precursor protein-binding, family A, member 3
domestic cat(101098282) amyloid beta (A4) precursor protein-binding, family A, member 3
cow(511925) amyloid beta (A4) precursor protein-binding, family A, member 3
dog(485053) amyloid beta (A4) precursor protein-binding, family A, member 3
domestic guinea pig(100730297) amyloid beta (A4) precursor protein-binding, family A, member 3
naked mole-rat(101703227) amyloid beta (A4) precursor protein-binding, family A, member 3
sheep(101115028) amyloid beta (A4) precursor protein-binding, family A, member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018758 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018758 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018758 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004886 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004886 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004886 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU035391 MISSION® esiRNA esiRNA targeting mouse Apba3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004886 Rosetta Predictions human pricing
NM_031781 Rosetta Predictions rat pricing
NM_018758 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004886 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057523 predicted 1043
2 SASI_Hs01_00057524 predicted 322
3 SASI_Hs01_00057525 predicted 1819
4 SASI_Hs01_00057526 predicted 1819
5 SASI_Hs01_00057527 predicted 991
6 SASI_Hs01_00057528 predicted 712
7 SASI_Hs01_00057529 predicted 1850
8 SASI_Hs01_00057530 predicted 530
9 SASI_Hs01_00057531 predicted 1857
10 SASI_Hs01_00057532 predicted 1817
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031781 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041105 predicted 1622
2 SASI_Rn01_00041106 predicted 849
3 SASI_Rn02_00265219 predicted 435
4 SASI_Rn01_00041107 predicted 1053
5 SASI_Rn01_00041108 predicted 1689
6 SASI_Rn01_00041109 predicted 1454
7 SASI_Rn01_00041110 predicted 851
8 SASI_Rn01_00041111 predicted 862
9 SASI_Rn01_00041112 predicted 857
10 SASI_Rn01_00041113 predicted 942
11 SASI_Rn01_00041114 predicted 935
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018758 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060917 predicted 567
2 SASI_Mm01_00060918 predicted 343
3 SASI_Mm01_00060919 predicted 1339
4 SASI_Mm01_00060920 predicted 1258
5 SASI_Mm01_00060921 predicted 503
6 SASI_Mm01_00060922 predicted 1605
7 SASI_Mm01_00060923 predicted 1192
8 SASI_Mm01_00060924 predicted 1263
9 SASI_Mm01_00060925 predicted 1014
10 SASI_Mm01_00060926 predicted 1070
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018758
VALIDATED
APBA3 MISSION shRNA Bacterial Glycerol Stock
amyloid beta (A4) precursor protein-binding, family A, member 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000313197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018758.2-1668s21c1
Sequence:CCGGATCCGTGACGCTGAGTATTATCTCGAGATAATACTCAGCGTCACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018758.2-1954s21c1
Sequence:CCGGGGACAGGAACAACCAGTATACCTCGAGGTATACTGGTTGTTCCTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018758.2-1045s21c1
Sequence:CCGGGTGGAAGTGGACATCTTTATCCTCGAGGATAAAGATGTCCACTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018758.2-1816s21c1
Sequence:CCGGCGCGTTGGACACCGCATCATTCTCGAGAATGATGCGGTGTCCAACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018758.2-1152s21c1
Sequence:CCGGCATTGGGCCTGTACTGGTCTTCTCGAGAAGACCAGTACAGGCCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018758.1-1182s1c1
Sequence:CCGGCTCTACAAGATGCTGTGCCATCTCGAGATGGCACAGCATCTTGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018758.1-1770s1c1
Sequence:CCGGCGCGTTGGACACCGCATCATTCTCGAGAATGATGCGGTGTCCAACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018758.1-1620s1c1
Sequence:CCGGTCATCCGTGACGCTGAGTATTCTCGAGAATACTCAGCGTCACGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018758.1-1187s1c1
Sequence:CCGGCAAGATGCTGTGCCATGTCTTCTCGAGAAGACATGGCACAGCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018758.1-1708s1c1
Sequence:CCGGGTGTGGAGGATGGAATCATTTCTCGAGAAATGATTCCATCCTCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018758
VALIDATED
APBA3 MISSION shRNA shRNA Plasmid DNA
amyloid beta (A4) precursor protein-binding, family A, member 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000313197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018758.2-1668s21c1
Sequence:CCGGATCCGTGACGCTGAGTATTATCTCGAGATAATACTCAGCGTCACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018758.2-1954s21c1
Sequence:CCGGGGACAGGAACAACCAGTATACCTCGAGGTATACTGGTTGTTCCTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018758.2-1045s21c1
Sequence:CCGGGTGGAAGTGGACATCTTTATCCTCGAGGATAAAGATGTCCACTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018758.2-1816s21c1
Sequence:CCGGCGCGTTGGACACCGCATCATTCTCGAGAATGATGCGGTGTCCAACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018758.2-1152s21c1
Sequence:CCGGCATTGGGCCTGTACTGGTCTTCTCGAGAAGACCAGTACAGGCCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018758.1-1182s1c1
Sequence:CCGGCTCTACAAGATGCTGTGCCATCTCGAGATGGCACAGCATCTTGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018758.1-1770s1c1
Sequence:CCGGCGCGTTGGACACCGCATCATTCTCGAGAATGATGCGGTGTCCAACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018758.1-1620s1c1
Sequence:CCGGTCATCCGTGACGCTGAGTATTCTCGAGAATACTCAGCGTCACGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018758.1-1187s1c1
Sequence:CCGGCAAGATGCTGTGCCATGTCTTCTCGAGAAGACATGGCACAGCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018758.1-1708s1c1
Sequence:CCGGGTGTGGAGGATGGAATCATTTCTCGAGAAATGATTCCATCCTCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018758
VALIDATED
APBA3 MISSION shRNA Lentiviral Transduction Particles
amyloid beta (A4) precursor protein-binding, family A, member 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000313197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018758.2-1668s21c1
Sequence:CCGGATCCGTGACGCTGAGTATTATCTCGAGATAATACTCAGCGTCACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018758.2-1954s21c1
Sequence:CCGGGGACAGGAACAACCAGTATACCTCGAGGTATACTGGTTGTTCCTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018758.2-1045s21c1
Sequence:CCGGGTGGAAGTGGACATCTTTATCCTCGAGGATAAAGATGTCCACTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018758.2-1816s21c1
Sequence:CCGGCGCGTTGGACACCGCATCATTCTCGAGAATGATGCGGTGTCCAACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018758.2-1152s21c1
Sequence:CCGGCATTGGGCCTGTACTGGTCTTCTCGAGAAGACCAGTACAGGCCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018758.1-1182s1c1
Sequence:CCGGCTCTACAAGATGCTGTGCCATCTCGAGATGGCACAGCATCTTGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018758.1-1770s1c1
Sequence:CCGGCGCGTTGGACACCGCATCATTCTCGAGAATGATGCGGTGTCCAACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018758.1-1620s1c1
Sequence:CCGGTCATCCGTGACGCTGAGTATTCTCGAGAATACTCAGCGTCACGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018758.1-1187s1c1
Sequence:CCGGCAAGATGCTGTGCCATGTCTTCTCGAGAAGACATGGCACAGCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018758.1-1708s1c1
Sequence:CCGGGTGTGGAGGATGGAATCATTTCTCGAGAAATGATTCCATCCTCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004886
APBA3 MISSION shRNA Bacterial Glycerol Stock
amyloid beta (A4) precursor protein-binding, family A, member 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004886.3-1155s1c1
Sequence:CCGGCAAGATGCTCTGCCACGTATTCTCGAGAATACGTGGCAGAGCATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204319    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004886.3-1329s1c1
Sequence:CCGGCCACTTCTCCAACAGTGACAACTCGAGTTGTCACTGTTGGAGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000203309    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004886.3-2003s1c1
Sequence:CCGGGTCCTGTATGATTTCCTAATACTCGAGTATTAGGAAATCATACAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004886.3-316s1c1
Sequence:CCGGCTCAGTCGGATGGAACTTGATCTCGAGATCAAGTTCCATCCGACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004886.3-320s1c1
Sequence:CCGGGTCGGATGGAACTTGATGAGTCTCGAGACTCATCAAGTTCCATCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004886.3-990s1c1
Sequence:CCGGCACCAAGAGGATCAAGGTCTTCTCGAGAAGACCTTGATCCTCTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004886.3-992s1c1
Sequence:CCGGCCAAGAGGATCAAGGTCTTGACTCGAGTCAAGACCTTGATCCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164702    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004886.3-1824s1c1
Sequence:CCGGCTATGGCGAGGTGCATATCAACTCGAGTTGATATGCACCTCGCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004886
APBA3 MISSION shRNA shRNA Plasmid DNA
amyloid beta (A4) precursor protein-binding, family A, member 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004886.3-1155s1c1
Sequence:CCGGCAAGATGCTCTGCCACGTATTCTCGAGAATACGTGGCAGAGCATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204319    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004886.3-1329s1c1
Sequence:CCGGCCACTTCTCCAACAGTGACAACTCGAGTTGTCACTGTTGGAGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000203309    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004886.3-2003s1c1
Sequence:CCGGGTCCTGTATGATTTCCTAATACTCGAGTATTAGGAAATCATACAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004886.3-316s1c1
Sequence:CCGGCTCAGTCGGATGGAACTTGATCTCGAGATCAAGTTCCATCCGACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004886.3-320s1c1
Sequence:CCGGGTCGGATGGAACTTGATGAGTCTCGAGACTCATCAAGTTCCATCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004886.3-990s1c1
Sequence:CCGGCACCAAGAGGATCAAGGTCTTCTCGAGAAGACCTTGATCCTCTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004886.3-992s1c1
Sequence:CCGGCCAAGAGGATCAAGGTCTTGACTCGAGTCAAGACCTTGATCCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164702    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004886.3-1824s1c1
Sequence:CCGGCTATGGCGAGGTGCATATCAACTCGAGTTGATATGCACCTCGCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004886
APBA3 MISSION shRNA Lentiviral Transduction Particles
amyloid beta (A4) precursor protein-binding, family A, member 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004886.3-1155s1c1
Sequence:CCGGCAAGATGCTCTGCCACGTATTCTCGAGAATACGTGGCAGAGCATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204319    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004886.3-1329s1c1
Sequence:CCGGCCACTTCTCCAACAGTGACAACTCGAGTTGTCACTGTTGGAGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000203309    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004886.3-2003s1c1
Sequence:CCGGGTCCTGTATGATTTCCTAATACTCGAGTATTAGGAAATCATACAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004886.3-316s1c1
Sequence:CCGGCTCAGTCGGATGGAACTTGATCTCGAGATCAAGTTCCATCCGACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004886.3-320s1c1
Sequence:CCGGGTCGGATGGAACTTGATGAGTCTCGAGACTCATCAAGTTCCATCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004886.3-990s1c1
Sequence:CCGGCACCAAGAGGATCAAGGTCTTCTCGAGAAGACCTTGATCCTCTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004886.3-992s1c1
Sequence:CCGGCCAAGAGGATCAAGGTCTTGACTCGAGTCAAGACCTTGATCCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164702    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004886.3-1824s1c1
Sequence:CCGGCTATGGCGAGGTGCATATCAACTCGAGTTGATATGCACCTCGCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks