EMAIL THIS PAGE TO A FRIEND

APBB1

amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65)

103 Gene Product Result for
Synonyms: FE65 MGC:9072 RIR
Gene ID:
Human(322) Summary: The protein encoded by this gene is a member of the Fe65 protein family. It is an adaptor protein localized in the nucleus. It interacts with the Alzheimer's disease amyloid precursor protein (APP), transcription factor CP2/LSF/LBP1 and the low-density lipoprotein receptor-related protein. APP functions as a cytosolic anchoring site that can prevent the gene product's nuclear translocation. This encoded protein could play an important role in the pathogenesis of Alzheimer's disease. It is thought to regulate transcription. Also it is observed to block cell cycle progression by downregulating thymidylate synthase expression. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Mar 2012]
Mouse(11785) amyloid beta (A4) precursor protein-binding, family B, member 1
Rat(29722) amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65)
Domestic Rabbit(100354159) amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65)
naked mole-rat(101699658) amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65)
domestic guinea pig(100735070) amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65)
Zebrafish(565164) amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65)
dog(476833) amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65)
cow(505096) amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65)
Horse(100069964) amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65)
domestic cat(101090045) amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65)
chicken(100859045) amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
A3735 Anti-APBB1 (191-205) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
A3860 Anti-APBB1 (401-415) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1300737 Anti-APBB1 (C-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunohistochemistry pricing
SAB1300738 Anti-APBB1 (center) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB1400015 Anti-APBB1 antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB2107121 Anti-APBB1 antibody produced in rabbit affinity isolated antibody guinea pig, mouse, horse, human, rabbit
ELISA, western blot pricing
HPA038521 Anti-APBB1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
HPA038522 Anti-APBB1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2500074 Anti-APBB1/FE65 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
F1429 Anti-Fe65 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse
western blot pricing
SAB1105206 Anti-phospho-APBB1 (pSer287) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1300718 Anti-Phospho-APBB1-S347 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009685 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009685 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009685 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001164 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001164 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001164 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001164 Rosetta Predictions human pricing
NM_145689 Rosetta Predictions human pricing
NM_080478 Rosetta Predictions rat pricing
NM_009685 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001164 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076972 predicted 1897
2 SASI_Hs01_00076973 predicted 2383
3 SASI_Hs01_00076974 predicted 1026
4 SASI_Hs01_00076976 predicted 2407
5 SASI_Hs01_00076977 predicted 881
6 SASI_Hs01_00076978 predicted 1864
7 SASI_Hs01_00076979 predicted 1695
8 SASI_Hs01_00076980 predicted 1853
9 SASI_Hs02_00331280 predicted 2058
10 SASI_Hs01_00076981 predicted 1940
11 SASI_Hs01_00076975 predicted 2402
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145689 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237489 predicted 1876
2 SASI_Hs01_00237490 predicted 2361
3 SASI_Hs01_00237491 predicted 1002
4 SASI_Hs01_00237493 predicted 2382
5 SASI_Hs01_00237494 predicted 872
6 SASI_Hs01_00237495 predicted 1842
7 SASI_Hs01_00237496 predicted 1678
8 SASI_Hs01_00237497 predicted 1831
9 SASI_Hs02_00365292 predicted 2037
10 SASI_Hs01_00237498 predicted 1916
11 SASI_Hs01_00237492 predicted 2376
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080478 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095489 predicted 1488
2 SASI_Rn01_00095490 predicted 973
3 SASI_Rn02_00267233 predicted 1771
4 SASI_Rn01_00095491 predicted 771
5 SASI_Rn01_00095492 predicted 1515
6 SASI_Rn02_00267234 predicted 1405
7 SASI_Rn01_00095493 predicted 931
8 SASI_Rn01_00095495 predicted 2284
9 SASI_Rn01_00095497 predicted 1436
10 SASI_Rn01_00095498 predicted 1509
11 SASI_Rn01_00095494 predicted 2313
12 SASI_Rn01_00095496 predicted 805
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009685 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316768 predicted 1833
2 SASI_Mm01_00067094 predicted 1070
3 SASI_Mm01_00067095 predicted 1317
4 SASI_Mm01_00067096 predicted 838
5 SASI_Mm01_00067097 predicted 2364
6 SASI_Mm01_00067098 predicted 1462
7 SASI_Mm01_00067099 predicted 1656
8 SASI_Mm01_00067100 predicted 1651
9 SASI_Mm01_00067101 predicted 1042
10 SASI_Mm01_00067102 predicted 1499
11 SASI_Mm01_00067103 predicted 1570
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009685
VALIDATED
APBB1 MISSION shRNA Bacterial Glycerol Stock
amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106525    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009685.1-2436s1c1
Sequence:CCGGCCAGTGTTTGAGGTAGAGCAACTCGAGTTGCTCTACCTCAAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009685.1-1691s1c1
Sequence:CCGGCCAAGTCTATTACCTGGGAAACTCGAGTTTCCCAGGTAATAGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009685.1-397s1c1
Sequence:CCGGCCAAAGGCTTAATGCATCTATCTCGAGATAGATGCATTAAGCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009685.1-689s1c1
Sequence:CCGGCCTCCTATTTGGCATGCGAAACTCGAGTTTCGCATGCCAAATAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009685.2-2359s21c1
Sequence:CCGGTTCCTTCACAGAAGTCATTACCTCGAGGTAATGACTTCTGTGAAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329014    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009685.2-2207s21c1
Sequence:CCGGCTTCCTCTGCCTGCTTGTTTGCTCGAGCAAACAAGCAGGCAGAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009685.2-318s21c1
Sequence:CCGGACCGAGACCAGAACCGAAATGCTCGAGCATTTCGGTTCTGGTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009685.2-1342s21c1
Sequence:CCGGGCTGGAGGACGAGACTCTAAACTCGAGTTTAGAGTCTCGTCCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009685.2-1488s21c1
Sequence:CCGGTGCTCAAGTGCCACGTGTTTCCTCGAGGAAACACGTGGCACTTGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009685.2-260s21c1
Sequence:CCGGGCCAATGCCAAGTGGTTAAAGCTCGAGCTTTAACCACTTGGCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009685
VALIDATED
APBB1 MISSION shRNA shRNA Plasmid DNA
amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106525    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009685.1-2436s1c1
Sequence:CCGGCCAGTGTTTGAGGTAGAGCAACTCGAGTTGCTCTACCTCAAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009685.1-1691s1c1
Sequence:CCGGCCAAGTCTATTACCTGGGAAACTCGAGTTTCCCAGGTAATAGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009685.1-397s1c1
Sequence:CCGGCCAAAGGCTTAATGCATCTATCTCGAGATAGATGCATTAAGCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009685.1-689s1c1
Sequence:CCGGCCTCCTATTTGGCATGCGAAACTCGAGTTTCGCATGCCAAATAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009685.2-2359s21c1
Sequence:CCGGTTCCTTCACAGAAGTCATTACCTCGAGGTAATGACTTCTGTGAAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329014    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009685.2-2207s21c1
Sequence:CCGGCTTCCTCTGCCTGCTTGTTTGCTCGAGCAAACAAGCAGGCAGAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009685.2-318s21c1
Sequence:CCGGACCGAGACCAGAACCGAAATGCTCGAGCATTTCGGTTCTGGTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009685.2-1342s21c1
Sequence:CCGGGCTGGAGGACGAGACTCTAAACTCGAGTTTAGAGTCTCGTCCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009685.2-1488s21c1
Sequence:CCGGTGCTCAAGTGCCACGTGTTTCCTCGAGGAAACACGTGGCACTTGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009685.2-260s21c1
Sequence:CCGGGCCAATGCCAAGTGGTTAAAGCTCGAGCTTTAACCACTTGGCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009685
VALIDATED
APBB1 MISSION shRNA Lentiviral Transduction Particles
amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106525    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009685.1-2436s1c1
Sequence:CCGGCCAGTGTTTGAGGTAGAGCAACTCGAGTTGCTCTACCTCAAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009685.1-1691s1c1
Sequence:CCGGCCAAGTCTATTACCTGGGAAACTCGAGTTTCCCAGGTAATAGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009685.1-397s1c1
Sequence:CCGGCCAAAGGCTTAATGCATCTATCTCGAGATAGATGCATTAAGCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009685.1-689s1c1
Sequence:CCGGCCTCCTATTTGGCATGCGAAACTCGAGTTTCGCATGCCAAATAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009685.2-2359s21c1
Sequence:CCGGTTCCTTCACAGAAGTCATTACCTCGAGGTAATGACTTCTGTGAAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329014    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009685.2-2207s21c1
Sequence:CCGGCTTCCTCTGCCTGCTTGTTTGCTCGAGCAAACAAGCAGGCAGAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009685.2-318s21c1
Sequence:CCGGACCGAGACCAGAACCGAAATGCTCGAGCATTTCGGTTCTGGTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009685.2-1342s21c1
Sequence:CCGGGCTGGAGGACGAGACTCTAAACTCGAGTTTAGAGTCTCGTCCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009685.2-1488s21c1
Sequence:CCGGTGCTCAAGTGCCACGTGTTTCCTCGAGGAAACACGTGGCACTTGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009685.2-260s21c1
Sequence:CCGGGCCAATGCCAAGTGGTTAAAGCTCGAGCTTTAACCACTTGGCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001164
APBB1 MISSION shRNA Bacterial Glycerol Stock
amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001164.2-1720s1c1
Sequence:CCGGCCAGAAGTTCCAAGTCTATTACTCGAGTAATAGACTTGGAACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001164.2-1582s1c1
Sequence:CCGGCCTGCATGAGATCTGCTCTAACTCGAGTTAGAGCAGATCTCATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001164.2-2413s1c1
Sequence:CCGGGTGATAACACTGGAGTGGTAACTCGAGTTACCACTCCAGTGTTATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001164.2-358s1c1
Sequence:CCGGCCAGAATCGCAATGTGACCTTCTCGAGAAGGTCACATTGCGATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001164.2-1585s1c1
Sequence:CCGGGCATGAGATCTGCTCTAAGATCTCGAGATCTTAGAGCAGATCTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001164
APBB1 MISSION shRNA shRNA Plasmid DNA
amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001164.2-1720s1c1
Sequence:CCGGCCAGAAGTTCCAAGTCTATTACTCGAGTAATAGACTTGGAACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001164.2-1582s1c1
Sequence:CCGGCCTGCATGAGATCTGCTCTAACTCGAGTTAGAGCAGATCTCATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001164.2-2413s1c1
Sequence:CCGGGTGATAACACTGGAGTGGTAACTCGAGTTACCACTCCAGTGTTATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001164.2-358s1c1
Sequence:CCGGCCAGAATCGCAATGTGACCTTCTCGAGAAGGTCACATTGCGATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001164.2-1585s1c1
Sequence:CCGGGCATGAGATCTGCTCTAAGATCTCGAGATCTTAGAGCAGATCTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001164
APBB1 MISSION shRNA Lentiviral Transduction Particles
amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001164.2-1720s1c1
Sequence:CCGGCCAGAAGTTCCAAGTCTATTACTCGAGTAATAGACTTGGAACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001164.2-1582s1c1
Sequence:CCGGCCTGCATGAGATCTGCTCTAACTCGAGTTAGAGCAGATCTCATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001164.2-2413s1c1
Sequence:CCGGGTGATAACACTGGAGTGGTAACTCGAGTTACCACTCCAGTGTTATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001164.2-358s1c1
Sequence:CCGGCCAGAATCGCAATGTGACCTTCTCGAGAAGGTCACATTGCGATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001164.2-1585s1c1
Sequence:CCGGGCATGAGATCTGCTCTAAGATCTCGAGATCTTAGAGCAGATCTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks