EMAIL THIS PAGE TO A FRIEND

APBB1IP

amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein

99 Gene Product Result for
Synonyms: INAG1 PREL1 RARP1 RIAM
UniProtKB ID: Q7Z5R6, Q8IWS8, Q8IZZ7
Gene ID:
Mouse(54519) amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein
Rat(307171) amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein
naked mole-rat(101700844) amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein
domestic guinea pig(100734595) amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein
Domestic Rabbit(100350673) amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein
Zebrafish(393607) amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein
cow(533670) amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein
Horse(100065539) amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein
domestic cat(101082668) amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein
dog(477985) amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein
chicken(420492) amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019043 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019043 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019043 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019456 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019456 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019456 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019043 Rosetta Predictions human pricing
XM_001053610 Rosetta Predictions rat pricing
XM_225631 Rosetta Predictions rat pricing
NM_019456 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019043 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038199 predicted 327
2 SASI_Hs01_00038200 predicted 358
3 SASI_Hs01_00038201 predicted 336
4 SASI_Hs01_00038202 predicted 390
5 SASI_Hs01_00038203 predicted 589
6 SASI_Hs02_00352612 predicted 919
7 SASI_Hs01_00038204 predicted 1228
8 SASI_Hs01_00038206 predicted 522
9 SASI_Hs01_00038207 predicted 343
10 SASI_Hs01_00038208 predicted 1354
11 SASI_Hs01_00038205 predicted 1224
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053610 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00272941 predicted 608
2 SASI_Rn02_00272942 predicted 201
3 SASI_Rn02_00272943 predicted 2034
4 SASI_Rn02_00272944 predicted 264
5 SASI_Rn02_00272945 predicted 434
6 SASI_Rn02_00272946 predicted 482
7 SASI_Rn02_00272947 predicted 251
8 SASI_Rn02_00272948 predicted 608
9 SASI_Rn02_00272949 predicted 213
10 SASI_Rn02_00272950 predicted 1553
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225631 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382984 predicted 2099
2 SASI_Rn02_00382985 predicted 2140
3 SASI_Rn02_00382986 predicted 2033
4 SASI_Rn02_00382987 predicted 2233
5 SASI_Rn02_00382988 predicted 1950
6 SASI_Rn02_00382989 predicted 2014
7 SASI_Rn02_00382990 predicted 1989
8 SASI_Rn02_00382991 predicted 2144
9 SASI_Rn02_00382992 predicted 2016
10 SASI_Rn02_00382993 predicted 2129
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019456 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095322 predicted 1659
2 SASI_Mm01_00095323 predicted 1381
3 SASI_Mm02_00324442 predicted 1009
4 SASI_Mm01_00095324 predicted 1776
5 SASI_Mm02_00324443 predicted 263
6 SASI_Mm02_00324444 predicted 1214
7 SASI_Mm02_00324445 predicted 878
8 SASI_Mm02_00324446 predicted 1128
9 SASI_Mm02_00324447 predicted 1117
10 SASI_Mm02_00324448 predicted 926
11 SASI_Mm01_00095321 predicted 1228
12 SASI_Mm01_00095325 predicted 1297
13 SASI_Mm01_00095326 predicted 1442
14 SASI_Mm01_00095327 predicted 1285
15 SASI_Mm01_00095328 predicted 1667
16 SASI_Mm01_00095329 predicted 269
17 SASI_Mm01_00095330 predicted 260
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019043
APBB1IP MISSION shRNA Bacterial Glycerol Stock
amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019043.3-611s21c1
Sequence:CCGGCATCTCTACAAGCATCAATTTCTCGAGAAATTGATGCTTGTAGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019043.3-1414s21c1
Sequence:CCGGTACTATGGGACTCAGCATAAACTCGAGTTTATGCTGAGTCCCATAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019043.3-2393s1c1
Sequence:CCGGGCCCTGACATCTTGTTCATTTCTCGAGAAATGAACAAGATGTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019043.3-1131s1c1
Sequence:CCGGCCAGAATTTCTACTTGGATAACTCGAGTTATCCAAGTAGAAATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019043.3-1195s1c1
Sequence:CCGGGCTAAGAACAAGGAATCCTTACTCGAGTAAGGATTCCTTGTTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019043.3-673s1c1
Sequence:CCGGGCCACTGGTATCAGCCAATATCTCGAGATATTGGCTGATACCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019043.3-1451s1c1
Sequence:CCGGCCACTGACTATTGCTTTGTTTCTCGAGAAACAAAGCAATAGTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019043
APBB1IP MISSION shRNA shRNA Plasmid DNA
amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019043.3-611s21c1
Sequence:CCGGCATCTCTACAAGCATCAATTTCTCGAGAAATTGATGCTTGTAGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019043.3-1414s21c1
Sequence:CCGGTACTATGGGACTCAGCATAAACTCGAGTTTATGCTGAGTCCCATAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019043.3-2393s1c1
Sequence:CCGGGCCCTGACATCTTGTTCATTTCTCGAGAAATGAACAAGATGTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019043.3-1131s1c1
Sequence:CCGGCCAGAATTTCTACTTGGATAACTCGAGTTATCCAAGTAGAAATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019043.3-1195s1c1
Sequence:CCGGGCTAAGAACAAGGAATCCTTACTCGAGTAAGGATTCCTTGTTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019043.3-673s1c1
Sequence:CCGGGCCACTGGTATCAGCCAATATCTCGAGATATTGGCTGATACCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019043.3-1451s1c1
Sequence:CCGGCCACTGACTATTGCTTTGTTTCTCGAGAAACAAAGCAATAGTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019043
APBB1IP MISSION shRNA Lentiviral Transduction Particles
amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019043.3-611s21c1
Sequence:CCGGCATCTCTACAAGCATCAATTTCTCGAGAAATTGATGCTTGTAGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019043.3-1414s21c1
Sequence:CCGGTACTATGGGACTCAGCATAAACTCGAGTTTATGCTGAGTCCCATAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019043.3-2393s1c1
Sequence:CCGGGCCCTGACATCTTGTTCATTTCTCGAGAAATGAACAAGATGTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019043.3-1131s1c1
Sequence:CCGGCCAGAATTTCTACTTGGATAACTCGAGTTATCCAAGTAGAAATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019043.3-1195s1c1
Sequence:CCGGGCTAAGAACAAGGAATCCTTACTCGAGTAAGGATTCCTTGTTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019043.3-673s1c1
Sequence:CCGGGCCACTGGTATCAGCCAATATCTCGAGATATTGGCTGATACCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019043.3-1451s1c1
Sequence:CCGGCCACTGACTATTGCTTTGTTTCTCGAGAAACAAAGCAATAGTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019456
APBB1IP MISSION shRNA Bacterial Glycerol Stock
amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019456.1-559s1c1
Sequence:CCGGGCCAAAGCAAAGGCTGATAAACTCGAGTTTATCAGCCTTTGCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019456.1-262s1c1
Sequence:CCGGGCACTGGAAGACCAAGATTTACTCGAGTAAATCTTGGTCTTCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019456.1-1082s1c1
Sequence:CCGGGCTACTTTCTTCTGAGAGCTTCTCGAGAAGCTCTCAGAAGAAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019456.1-529s1c1
Sequence:CCGGCCTGAACTTCTCTCTAAAGAACTCGAGTTCTTTAGAGAGAAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019456.1-1081s1c1
Sequence:CCGGCGCTACTTTCTTCTGAGAGCTCTCGAGAGCTCTCAGAAGAAAGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019456
APBB1IP MISSION shRNA shRNA Plasmid DNA
amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019456.1-559s1c1
Sequence:CCGGGCCAAAGCAAAGGCTGATAAACTCGAGTTTATCAGCCTTTGCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019456.1-262s1c1
Sequence:CCGGGCACTGGAAGACCAAGATTTACTCGAGTAAATCTTGGTCTTCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019456.1-1082s1c1
Sequence:CCGGGCTACTTTCTTCTGAGAGCTTCTCGAGAAGCTCTCAGAAGAAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019456.1-529s1c1
Sequence:CCGGCCTGAACTTCTCTCTAAAGAACTCGAGTTCTTTAGAGAGAAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019456.1-1081s1c1
Sequence:CCGGCGCTACTTTCTTCTGAGAGCTCTCGAGAGCTCTCAGAAGAAAGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019456
APBB1IP MISSION shRNA Lentiviral Transduction Particles
amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019456.1-559s1c1
Sequence:CCGGGCCAAAGCAAAGGCTGATAAACTCGAGTTTATCAGCCTTTGCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019456.1-262s1c1
Sequence:CCGGGCACTGGAAGACCAAGATTTACTCGAGTAAATCTTGGTCTTCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019456.1-1082s1c1
Sequence:CCGGGCTACTTTCTTCTGAGAGCTTCTCGAGAAGCTCTCAGAAGAAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019456.1-529s1c1
Sequence:CCGGCCTGAACTTCTCTCTAAAGAACTCGAGTTCTTTAGAGAGAAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019456.1-1081s1c1
Sequence:CCGGCGCTACTTTCTTCTGAGAGCTCTCGAGAGCTCTCAGAAGAAAGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks