EMAIL THIS PAGE TO A FRIEND

APBB2

amyloid beta (A4) precursor protein-binding, family B, member 2

139 Gene Product Result for
Synonyms: FE65L FE65L1
UniProtKB ID: Q92870, B4DSL4, E9PG87, Q8IUI6
Gene ID:
Human(323) Summary: The protein encoded by this gene interacts with the cytoplasmic domains of amyloid beta (A4) precursor protein and amyloid beta (A4) precursor-like protein 2. This protein contains two phosphotyrosine binding (PTB) domains, which are thought to function in signal transduction. Polymorphisms in this gene have been associated with Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Mouse(11787) amyloid beta (A4) precursor protein-binding, family B, member 2
Rat(305338) amyloid beta (A4) precursor protein-binding, family B, member 2
chicken(422781) amyloid beta (A4) precursor protein-binding, family B, member 2
cow(514013) amyloid beta (A4) precursor protein-binding, family B, member 2
Horse(100054890) amyloid beta (A4) precursor protein-binding, family B, member 2
dog(488831) amyloid beta (A4) precursor protein-binding, family B, member 2
sheep(101116399) amyloid beta (A4) precursor protein-binding, family B, member 2
Domestic Rabbit(100353587) amyloid beta (A4) precursor protein-binding, family B, member 2
domestic guinea pig(100718217) amyloid beta (A4) precursor protein-binding, family B, member 2
naked mole-rat(101703251) amyloid beta (A4) precursor protein-binding, family B, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009686 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009686 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009686 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173075 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173075 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173075 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU060241 MISSION® esiRNA esiRNA human APBB2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173075 Rosetta Predictions human pricing
XM_001077874 Rosetta Predictions rat pricing
XM_223399 Rosetta Predictions rat pricing
NM_009686 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173075 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215338 predicted 1085
2 SASI_Hs02_00368063 predicted 1730
3 SASI_Hs01_00215339 predicted 1073
4 SASI_Hs01_00215341 predicted 1176
5 SASI_Hs02_00368064 predicted 2218
6 SASI_Hs02_00368065 predicted 956
7 SASI_Hs01_00215342 predicted 2196
8 SASI_Hs01_00215343 predicted 2254
9 SASI_Hs01_00215344 predicted 546
10 SASI_Hs01_00215345 predicted 1308
11 SASI_Hs01_00215337 predicted 2412
12 SASI_Hs01_00215340 predicted 513
13 SASI_Hs01_00215346 predicted 1336
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077874 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00358855 predicted 497
2 SASI_Rn02_00358856 predicted 1562
3 SASI_Rn02_00358857 predicted 928
4 SASI_Rn02_00358858 predicted 426
5 SASI_Rn02_00358859 predicted 1857
6 SASI_Rn02_00358860 predicted 1245
7 SASI_Rn02_00358861 predicted 2074
8 SASI_Rn02_00358862 predicted 1117
9 SASI_Rn02_00358863 predicted 700
10 SASI_Rn02_00358864 predicted 1602
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223399 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381335 predicted 211
2 SASI_Rn02_00381336 predicted 1280
3 SASI_Rn02_00381337 predicted 642
4 SASI_Rn02_00381338 predicted 1573
5 SASI_Rn02_00381339 predicted 954
6 SASI_Rn02_00381340 predicted 1788
7 SASI_Rn02_00381341 predicted 834
8 SASI_Rn02_00381342 predicted 1146
9 SASI_Rn02_00381343 predicted 422
10 SASI_Rn02_00381344 predicted 1318
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009686 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089716 predicted 886
2 SASI_Mm01_00089717 predicted 489
3 SASI_Mm01_00089718 predicted 2464
4 SASI_Mm01_00089719 predicted 2736
5 SASI_Mm01_00089721 predicted 1634
6 SASI_Mm01_00089722 predicted 1988
7 SASI_Mm02_00316769 predicted 1526
8 SASI_Mm01_00089723 predicted 1511
9 SASI_Mm02_00316770 predicted 1972
10 SASI_Mm01_00089724 predicted 2209
11 SASI_Mm01_00089720 predicted 2532
12 SASI_Mm01_00089725 predicted 2089
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009686
VALIDATED
APBB2 MISSION shRNA Bacterial Glycerol Stock
amyloid beta (A4) precursor protein-binding, family B, member 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054423    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009686.1-3009s1c1
Sequence:CCGGGCCAACTAACACTGCATCCTTCTCGAGAAGGATGCAGTGTTAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009686.1-708s1c1
Sequence:CCGGGCCAACATCAAGCTGGTTAAACTCGAGTTTAACCAGCTTGATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009686.1-1411s1c1
Sequence:CCGGGCTCTAGGAAAGGGTCACTTACTCGAGTAAGTGACCCTTTCCTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009686.1-1637s1c1
Sequence:CCGGCGATGATTCTTGTAGTATCAACTCGAGTTGATACTACAAGAATCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009686.1-2054s1c1
Sequence:CCGGCCACGAAATCTGCTCCAAGATCTCGAGATCTTGGAGCAGATTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009686.1-2206s21c1
Sequence:CCGGTGCAGTACCTGGGCATGTTACCTCGAGGTAACATGCCCAGGTACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009686.1-2865s21c1
Sequence:CCGGGCCGCCACCATGTGATATAAACTCGAGTTTATATCACATGGTGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009686.1-1325s21c1
Sequence:CCGGTGACATTGCCGGGACCTATTACTCGAGTAATAGGTCCCGGCAATGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009686.1-819s21c1
Sequence:CCGGTCCGAGAAGCTGGAGGTTAAACTCGAGTTTAACCTCCAGCTTCTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009686.1-2042s21c1
Sequence:CCGGTGCCACAAGTCTCCACGAAATCTCGAGATTTCGTGGAGACTTGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009686
VALIDATED
APBB2 MISSION shRNA shRNA Plasmid DNA
amyloid beta (A4) precursor protein-binding, family B, member 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054423    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009686.1-3009s1c1
Sequence:CCGGGCCAACTAACACTGCATCCTTCTCGAGAAGGATGCAGTGTTAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009686.1-708s1c1
Sequence:CCGGGCCAACATCAAGCTGGTTAAACTCGAGTTTAACCAGCTTGATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009686.1-1411s1c1
Sequence:CCGGGCTCTAGGAAAGGGTCACTTACTCGAGTAAGTGACCCTTTCCTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009686.1-1637s1c1
Sequence:CCGGCGATGATTCTTGTAGTATCAACTCGAGTTGATACTACAAGAATCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009686.1-2054s1c1
Sequence:CCGGCCACGAAATCTGCTCCAAGATCTCGAGATCTTGGAGCAGATTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009686.1-2206s21c1
Sequence:CCGGTGCAGTACCTGGGCATGTTACCTCGAGGTAACATGCCCAGGTACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009686.1-2865s21c1
Sequence:CCGGGCCGCCACCATGTGATATAAACTCGAGTTTATATCACATGGTGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009686.1-1325s21c1
Sequence:CCGGTGACATTGCCGGGACCTATTACTCGAGTAATAGGTCCCGGCAATGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009686.1-819s21c1
Sequence:CCGGTCCGAGAAGCTGGAGGTTAAACTCGAGTTTAACCTCCAGCTTCTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009686.1-2042s21c1
Sequence:CCGGTGCCACAAGTCTCCACGAAATCTCGAGATTTCGTGGAGACTTGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009686
VALIDATED
APBB2 MISSION shRNA Lentiviral Transduction Particles
amyloid beta (A4) precursor protein-binding, family B, member 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054423    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009686.1-3009s1c1
Sequence:CCGGGCCAACTAACACTGCATCCTTCTCGAGAAGGATGCAGTGTTAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009686.1-708s1c1
Sequence:CCGGGCCAACATCAAGCTGGTTAAACTCGAGTTTAACCAGCTTGATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009686.1-1411s1c1
Sequence:CCGGGCTCTAGGAAAGGGTCACTTACTCGAGTAAGTGACCCTTTCCTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009686.1-1637s1c1
Sequence:CCGGCGATGATTCTTGTAGTATCAACTCGAGTTGATACTACAAGAATCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009686.1-2054s1c1
Sequence:CCGGCCACGAAATCTGCTCCAAGATCTCGAGATCTTGGAGCAGATTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009686.1-2206s21c1
Sequence:CCGGTGCAGTACCTGGGCATGTTACCTCGAGGTAACATGCCCAGGTACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009686.1-2865s21c1
Sequence:CCGGGCCGCCACCATGTGATATAAACTCGAGTTTATATCACATGGTGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009686.1-1325s21c1
Sequence:CCGGTGACATTGCCGGGACCTATTACTCGAGTAATAGGTCCCGGCAATGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009686.1-819s21c1
Sequence:CCGGTCCGAGAAGCTGGAGGTTAAACTCGAGTTTAACCTCCAGCTTCTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009686.1-2042s21c1
Sequence:CCGGTGCCACAAGTCTCCACGAAATCTCGAGATTTCGTGGAGACTTGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173075
VALIDATED
APBB2 MISSION shRNA Bacterial Glycerol Stock
amyloid beta (A4) precursor protein-binding, family B, member 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173075.1-1748s1c1
Sequence:CCGGCAGGCAACTTTCCTACTGCAACTCGAGTTGCAGTAGGAAAGTTGCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173075.1-2505s1c1
Sequence:CCGGGCCGCCTGCATGTTACGATATCTCGAGATATCGTAACATGCAGGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_173075.1-1941s1c1
Sequence:CCGGGCTTATGTAGCAAGAGATAAACTCGAGTTTATCTCTTGCTACATAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173075.1-2520s1c1
Sequence:CCGGCGATATCAGAAGTGCTTGGTACTCGAGTACCAAGCACTTCTGATATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_173075.1-2340s1c1
Sequence:CCGGGAAGAGGAAGTCTTAGTGGAACTCGAGTTCCACTAAGACTTCCTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173075.4-2814s21c1
Sequence:CCGGGAAACGCCCTGTCACCGAAATCTCGAGATTTCGGTGACAGGGCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173075.4-1729s21c1
Sequence:CCGGACCCTACGCTATGCATCTTTGCTCGAGCAAAGATGCATAGCGTAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173075.4-1025s21c1
Sequence:CCGGCTGAGAAGTTAGAGGGTAAAGCTCGAGCTTTACCCTCTAACTTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173075.4-1531s21c1
Sequence:CCGGGACATTGCCGGGACCTATTATCTCGAGATAATAGGTCCCGGCAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173075.4-1100s21c1
Sequence:CCGCGAACTAAGAGCTTCCTAAATTCTCGAGAATTTAGGAAGCTCTTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173075.4-1937s21c1
Sequence:CCGGTCCGAGACACAGTCGGGATTTCTCGAGAAATCCCGACTGTGTCTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173075
VALIDATED
APBB2 MISSION shRNA shRNA Plasmid DNA
amyloid beta (A4) precursor protein-binding, family B, member 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173075.1-1748s1c1
Sequence:CCGGCAGGCAACTTTCCTACTGCAACTCGAGTTGCAGTAGGAAAGTTGCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173075.1-2505s1c1
Sequence:CCGGGCCGCCTGCATGTTACGATATCTCGAGATATCGTAACATGCAGGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_173075.1-1941s1c1
Sequence:CCGGGCTTATGTAGCAAGAGATAAACTCGAGTTTATCTCTTGCTACATAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173075.1-2520s1c1
Sequence:CCGGCGATATCAGAAGTGCTTGGTACTCGAGTACCAAGCACTTCTGATATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_173075.1-2340s1c1
Sequence:CCGGGAAGAGGAAGTCTTAGTGGAACTCGAGTTCCACTAAGACTTCCTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173075.4-2814s21c1
Sequence:CCGGGAAACGCCCTGTCACCGAAATCTCGAGATTTCGGTGACAGGGCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173075.4-1729s21c1
Sequence:CCGGACCCTACGCTATGCATCTTTGCTCGAGCAAAGATGCATAGCGTAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173075.4-1025s21c1
Sequence:CCGGCTGAGAAGTTAGAGGGTAAAGCTCGAGCTTTACCCTCTAACTTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173075.4-1531s21c1
Sequence:CCGGGACATTGCCGGGACCTATTATCTCGAGATAATAGGTCCCGGCAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173075.4-1100s21c1
Sequence:CCGCGAACTAAGAGCTTCCTAAATTCTCGAGAATTTAGGAAGCTCTTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173075.4-1937s21c1
Sequence:CCGGTCCGAGACACAGTCGGGATTTCTCGAGAAATCCCGACTGTGTCTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173075
VALIDATED
APBB2 MISSION shRNA Lentiviral Transduction Particles
amyloid beta (A4) precursor protein-binding, family B, member 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173075.1-1748s1c1
Sequence:CCGGCAGGCAACTTTCCTACTGCAACTCGAGTTGCAGTAGGAAAGTTGCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173075.1-2505s1c1
Sequence:CCGGGCCGCCTGCATGTTACGATATCTCGAGATATCGTAACATGCAGGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_173075.1-1941s1c1
Sequence:CCGGGCTTATGTAGCAAGAGATAAACTCGAGTTTATCTCTTGCTACATAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173075.1-2520s1c1
Sequence:CCGGCGATATCAGAAGTGCTTGGTACTCGAGTACCAAGCACTTCTGATATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_173075.1-2340s1c1
Sequence:CCGGGAAGAGGAAGTCTTAGTGGAACTCGAGTTCCACTAAGACTTCCTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173075.4-2814s21c1
Sequence:CCGGGAAACGCCCTGTCACCGAAATCTCGAGATTTCGGTGACAGGGCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173075.4-1729s21c1
Sequence:CCGGACCCTACGCTATGCATCTTTGCTCGAGCAAAGATGCATAGCGTAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173075.4-1025s21c1
Sequence:CCGGCTGAGAAGTTAGAGGGTAAAGCTCGAGCTTTACCCTCTAACTTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173075.4-1531s21c1
Sequence:CCGGGACATTGCCGGGACCTATTATCTCGAGATAATAGGTCCCGGCAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173075.4-1100s21c1
Sequence:CCGCGAACTAAGAGCTTCCTAAATTCTCGAGAATTTAGGAAGCTCTTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173075.4-1937s21c1
Sequence:CCGGTCCGAGACACAGTCGGGATTTCTCGAGAAATCCCGACTGTGTCTCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks