EMAIL THIS PAGE TO A FRIEND

APBB3

amyloid beta (A4) precursor protein-binding, family B, member 3

109 Gene Product Result for
Synonyms: FE65L2 SRA
UniProtKB ID: O95704, B3KQN9, Q08AG4, Q9NYX6, Q9NYX7, Q9NYX8
Gene ID:
Human(10307) Summary: The protein encoded by this gene is a member of the APBB protein family. It is found in the cytoplasm and binds to the intracellular domain of the Alzheimer's disease beta-amyloid precursor protein (APP) as well as to other APP-like proteins. It is thought that the protein encoded by this gene may modulate the internalization of APP. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(225372) amyloid beta (A4) precursor protein-binding, family B, member 3
Rat(117026) amyloid beta (A4) precursor protein-binding, family B, member 3
chicken(427608) amyloid beta (A4) precursor protein-binding, family B, member 3
chicken(101750838) amyloid beta (A4) precursor protein-binding, family B, member 3
chicken(101667166) amyloid beta (A4) precursor protein-binding, family B, member 3
domestic cat(101095149) amyloid beta (A4) precursor protein-binding, family B, member 3
cow(525278) amyloid beta (A4) precursor protein-binding, family B, member 3
Horse(100061937) amyloid beta (A4) precursor protein-binding, family B, member 3
dog(606955) amyloid beta (A4) precursor protein-binding, family B, member 3
naked mole-rat(101707069) amyloid beta (A4) precursor protein-binding, family B, member 3
domestic guinea pig(100716112) amyloid beta (A4) precursor protein-binding, family B, member 3
sheep(101118948) amyloid beta (A4) precursor protein-binding, family B, member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006051 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006051 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006051 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146085 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146085 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146085 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006051 Rosetta Predictions human pricing
NM_133172 Rosetta Predictions human pricing
NM_133173 Rosetta Predictions human pricing
NM_133174 Rosetta Predictions human pricing
NM_053957 Rosetta Predictions rat pricing
NM_146085 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006051 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077288 predicted 625
2 SASI_Hs01_00077289 predicted 1288
3 SASI_Hs01_00077290 predicted 466
4 SASI_Hs01_00077291 predicted 1600
5 SASI_Hs01_00077292 predicted 1827
6 SASI_Hs01_00077293 predicted 1587
7 SASI_Hs01_00077295 predicted 475
8 SASI_Hs01_00077296 predicted 1242
9 SASI_Hs01_00077297 predicted 639
10 SASI_Hs02_00340805 predicted 1366
11 SASI_Hs01_00077294 predicted 1866
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133172 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228815 predicted 630
2 SASI_Hs01_00228816 predicted 1282
3 SASI_Hs01_00228817 predicted 470
4 SASI_Hs01_00228818 predicted 1596
5 SASI_Hs01_00228819 predicted 1814
6 SASI_Hs01_00228820 predicted 1583
7 SASI_Hs01_00228822 predicted 467
8 SASI_Hs01_00228823 predicted 1232
9 SASI_Hs01_00228824 predicted 638
10 SASI_Hs02_00362932 predicted 1359
11 SASI_Hs01_00228821 predicted 1851
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133173 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247434 predicted 624
2 SASI_Hs01_00247435 predicted 1272
3 SASI_Hs01_00247436 predicted 463
4 SASI_Hs01_00247437 predicted 1581
5 SASI_Hs01_00247438 predicted 1806
6 SASI_Hs01_00247439 predicted 1566
7 SASI_Hs01_00247441 predicted 474
8 SASI_Hs01_00247442 predicted 1218
9 SASI_Hs01_00247443 predicted 639
10 SASI_Hs02_00362933 predicted 1353
11 SASI_Hs01_00247440 predicted 1846
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133174 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176620 predicted 622
2 SASI_Hs01_00176621 predicted 1260
3 SASI_Hs01_00176622 predicted 469
4 SASI_Hs01_00176623 predicted 1571
5 SASI_Hs01_00176624 predicted 1801
6 SASI_Hs01_00176625 predicted 1562
7 SASI_Hs01_00176627 predicted 472
8 SASI_Hs01_00176628 predicted 1218
9 SASI_Hs01_00176629 predicted 642
10 SASI_Hs02_00362934 predicted 1343
11 SASI_Hs01_00176626 predicted 1839
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053957 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050614 predicted 572
2 SASI_Rn01_00050615 predicted 1377
3 SASI_Rn01_00050616 predicted 948
4 SASI_Rn02_00266917 predicted 1350
5 SASI_Rn01_00050617 predicted 1752
6 SASI_Rn02_00266918 predicted 1195
7 SASI_Rn01_00050618 predicted 555
8 SASI_Rn01_00050619 predicted 1718
9 SASI_Rn01_00050620 predicted 584
10 SASI_Rn01_00050621 predicted 1726
11 SASI_Rn01_00050613 predicted 932
12 SASI_Rn01_00050622 predicted 852
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146085 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061995 predicted 985
2 SASI_Mm01_00061996 predicted 610
3 SASI_Mm02_00341720 predicted 1396
4 SASI_Mm01_00061997 predicted 584
5 SASI_Mm01_00061998 predicted 731
6 SASI_Mm01_00061999 predicted 1763
7 SASI_Mm01_00062000 predicted 1768
8 SASI_Mm01_00062001 predicted 1223
9 SASI_Mm01_00062002 predicted 620
10 SASI_Mm01_00062003 predicted 1732
11 SASI_Mm01_00062004 predicted 1804
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006051
APBB3 MISSION shRNA Bacterial Glycerol Stock
amyloid beta (A4) precursor protein-binding, family B, member 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006051.3-633s21c1
Sequence:CCGGAGTTCACTGGACCGGAGTAACCTCGAGGTTACTCCGGTCCAGTGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006051.3-1246s21c1
Sequence:CCGGAGAAGTACGAGGCACTGTATACTCGAGTATACAGTGCCTCGTACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006051.2-483s1c1
Sequence:CCGGGCAGGTACTTACTACTGGCATCTCGAGATGCCAGTAGTAAGTACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006051.2-1461s1c1
Sequence:CCGGCTTGTGACATTTATTGGTGTTCTCGAGAACACCAATAAATGTCACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006051.2-1605s1c1
Sequence:CCGGGTTCAGTACCAGAAGTGTCTTCTCGAGAAGACACTTCTGGTACTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006051.2-773s1c1
Sequence:CCGGGAGCAGTATTGCAGTCAATAACTCGAGTTATTGACTGCAATACTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006051.2-1030s1c1
Sequence:CCGGCAAGTGACAAAGATAGCTGTACTCGAGTACAGCTATCTTTGTCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006051
APBB3 MISSION shRNA shRNA Plasmid DNA
amyloid beta (A4) precursor protein-binding, family B, member 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006051.3-633s21c1
Sequence:CCGGAGTTCACTGGACCGGAGTAACCTCGAGGTTACTCCGGTCCAGTGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006051.3-1246s21c1
Sequence:CCGGAGAAGTACGAGGCACTGTATACTCGAGTATACAGTGCCTCGTACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006051.2-483s1c1
Sequence:CCGGGCAGGTACTTACTACTGGCATCTCGAGATGCCAGTAGTAAGTACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006051.2-1461s1c1
Sequence:CCGGCTTGTGACATTTATTGGTGTTCTCGAGAACACCAATAAATGTCACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006051.2-1605s1c1
Sequence:CCGGGTTCAGTACCAGAAGTGTCTTCTCGAGAAGACACTTCTGGTACTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006051.2-773s1c1
Sequence:CCGGGAGCAGTATTGCAGTCAATAACTCGAGTTATTGACTGCAATACTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006051.2-1030s1c1
Sequence:CCGGCAAGTGACAAAGATAGCTGTACTCGAGTACAGCTATCTTTGTCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006051
APBB3 MISSION shRNA Lentiviral Transduction Particles
amyloid beta (A4) precursor protein-binding, family B, member 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006051.3-633s21c1
Sequence:CCGGAGTTCACTGGACCGGAGTAACCTCGAGGTTACTCCGGTCCAGTGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006051.3-1246s21c1
Sequence:CCGGAGAAGTACGAGGCACTGTATACTCGAGTATACAGTGCCTCGTACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006051.2-483s1c1
Sequence:CCGGGCAGGTACTTACTACTGGCATCTCGAGATGCCAGTAGTAAGTACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006051.2-1461s1c1
Sequence:CCGGCTTGTGACATTTATTGGTGTTCTCGAGAACACCAATAAATGTCACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006051.2-1605s1c1
Sequence:CCGGGTTCAGTACCAGAAGTGTCTTCTCGAGAAGACACTTCTGGTACTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006051.2-773s1c1
Sequence:CCGGGAGCAGTATTGCAGTCAATAACTCGAGTTATTGACTGCAATACTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006051.2-1030s1c1
Sequence:CCGGCAAGTGACAAAGATAGCTGTACTCGAGTACAGCTATCTTTGTCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146085
VALIDATED
APBB3 MISSION shRNA Bacterial Glycerol Stock
amyloid beta (A4) precursor protein-binding, family B, member 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000306440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146085.1-1211s21c1
Sequence:CCGGGGATCCTACCAGTCACTAAAGCTCGAGCTTTAGTGACTGGTAGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146085.1-1235s21c1
Sequence:CCGGTGGGTATGGATGTGCTGAATGCTCGAGCATTCAGCACATCCATACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306441    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146085.1-1831s21c1
Sequence:CCGGTAGGGTTCTGTAGCCTCTTACCTCGAGGTAAGAGGCTACAGAACCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146085.1-1773s21c1
Sequence:CCGGTATGTCCTAACTTGATCTTAGCTCGAGCTAAGATCAAGTTAGGACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146085.1-1396s21c1
Sequence:CCGGGTTCGCCTTGTAACCTTTATTCTCGAGAATAAAGGTTACAAGGCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119617    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146085.1-1871s1c1
Sequence:CCGGCCTTGCCTACTCTGTATTTATCTCGAGATAAATACAGAGTAGGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146085.1-610s1c1
Sequence:CCGGAGTAACTCTCTAACATGGTATCTCGAGATACCATGTTAGAGAGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146085.1-1396s1c1
Sequence:CCGGGTTCGCCTTGTAACCTTTATTCTCGAGAATAAAGGTTACAAGGCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146085.1-445s1c1
Sequence:CCGGGCAGGAACTTATTATTGGCATCTCGAGATGCCAATAATAAGTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146085.1-594s1c1
Sequence:CCGGCAGTTCATTGAACCGGAGTAACTCGAGTTACTCCGGTTCAATGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146085
VALIDATED
APBB3 MISSION shRNA shRNA Plasmid DNA
amyloid beta (A4) precursor protein-binding, family B, member 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000306440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146085.1-1211s21c1
Sequence:CCGGGGATCCTACCAGTCACTAAAGCTCGAGCTTTAGTGACTGGTAGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146085.1-1235s21c1
Sequence:CCGGTGGGTATGGATGTGCTGAATGCTCGAGCATTCAGCACATCCATACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306441    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146085.1-1831s21c1
Sequence:CCGGTAGGGTTCTGTAGCCTCTTACCTCGAGGTAAGAGGCTACAGAACCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146085.1-1773s21c1
Sequence:CCGGTATGTCCTAACTTGATCTTAGCTCGAGCTAAGATCAAGTTAGGACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146085.1-1396s21c1
Sequence:CCGGGTTCGCCTTGTAACCTTTATTCTCGAGAATAAAGGTTACAAGGCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119617    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146085.1-1871s1c1
Sequence:CCGGCCTTGCCTACTCTGTATTTATCTCGAGATAAATACAGAGTAGGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146085.1-610s1c1
Sequence:CCGGAGTAACTCTCTAACATGGTATCTCGAGATACCATGTTAGAGAGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146085.1-1396s1c1
Sequence:CCGGGTTCGCCTTGTAACCTTTATTCTCGAGAATAAAGGTTACAAGGCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146085.1-445s1c1
Sequence:CCGGGCAGGAACTTATTATTGGCATCTCGAGATGCCAATAATAAGTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146085.1-594s1c1
Sequence:CCGGCAGTTCATTGAACCGGAGTAACTCGAGTTACTCCGGTTCAATGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146085
VALIDATED
APBB3 MISSION shRNA Lentiviral Transduction Particles
amyloid beta (A4) precursor protein-binding, family B, member 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000306440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146085.1-1211s21c1
Sequence:CCGGGGATCCTACCAGTCACTAAAGCTCGAGCTTTAGTGACTGGTAGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146085.1-1235s21c1
Sequence:CCGGTGGGTATGGATGTGCTGAATGCTCGAGCATTCAGCACATCCATACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306441    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146085.1-1831s21c1
Sequence:CCGGTAGGGTTCTGTAGCCTCTTACCTCGAGGTAAGAGGCTACAGAACCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146085.1-1773s21c1
Sequence:CCGGTATGTCCTAACTTGATCTTAGCTCGAGCTAAGATCAAGTTAGGACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146085.1-1396s21c1
Sequence:CCGGGTTCGCCTTGTAACCTTTATTCTCGAGAATAAAGGTTACAAGGCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119617    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146085.1-1871s1c1
Sequence:CCGGCCTTGCCTACTCTGTATTTATCTCGAGATAAATACAGAGTAGGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146085.1-610s1c1
Sequence:CCGGAGTAACTCTCTAACATGGTATCTCGAGATACCATGTTAGAGAGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146085.1-1396s1c1
Sequence:CCGGGTTCGCCTTGTAACCTTTATTCTCGAGAATAAAGGTTACAAGGCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146085.1-445s1c1
Sequence:CCGGGCAGGAACTTATTATTGGCATCTCGAGATGCCAATAATAAGTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146085.1-594s1c1
Sequence:CCGGCAGTTCATTGAACCGGAGTAACTCGAGTTACTCCGGTTCAATGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks