EMAIL THIS PAGE TO A FRIEND

APC2

adenomatosis polyposis coli 2

52 Gene Product Result for
Synonyms: APCL
Gene ID:
Mouse(23805) adenomatosis polyposis coli 2
Rat(299611) adenomatosis polyposis coli 2
Zebrafish(565771) adenomatosis polyposis coli 2
cow(526572) adenomatosis polyposis coli 2
Horse(100147102) adenomatosis polyposis coli 2
domestic cat(101097211) adenomatosis polyposis coli 2
dog(485084) adenomatosis polyposis coli 2
chicken(429363) adenomatosis polyposis coli 2
Thale Cress(815008) anaphase-promoting complex subunit 2
fruit fly(42871) Adenomatous polyposis coli tumor suppressor homolog 2
naked mole-rat(101699189) adenomatosis polyposis coli 2
domestic guinea pig(100735498) adenomatosis polyposis coli 2
sheep(101115458) adenomatosis polyposis coli 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005883 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005883 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005883 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011789 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011789 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011789 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU035841 MISSION® esiRNA esiRNA targeting mouse Apc2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005883 Rosetta Predictions human pricing
NM_001106769 Rosetta Predictions rat pricing
NM_011789 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005883 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178705 predicted 2795
2 SASI_Hs01_00178706 predicted 334
3 SASI_Hs02_00340478 predicted 350
4 SASI_Hs01_00178707 predicted 3004
5 SASI_Hs01_00178708 predicted 1964
6 SASI_Hs01_00178709 predicted 3391
7 SASI_Hs01_00178711 predicted 775
8 SASI_Hs01_00178712 predicted 4722
9 SASI_Hs01_00178713 predicted 5358
10 SASI_Hs02_00340479 predicted 442
11 SASI_Hs01_00178710 predicted 1613
12 SASI_Hs01_00178714 predicted 4636
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106769 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222218 predicted 491
2 SASI_Rn02_00222219 predicted 1559
3 SASI_Rn02_00222220 predicted 234
4 SASI_Rn02_00222221 predicted 2142
5 SASI_Rn02_00222222 predicted 3405
6 SASI_Rn02_00222223 predicted 4901
7 SASI_Rn02_00222224 predicted 1264
8 SASI_Rn02_00222225 predicted 3083
9 SASI_Rn02_00222226 predicted 2975
10 SASI_Rn02_00222227 predicted 4486
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011789 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163155 predicted 3249
2 SASI_Mm01_00163156 predicted 4899
3 SASI_Mm01_00163157 predicted 463
4 SASI_Mm01_00163159 predicted 1259
5 SASI_Mm01_00163160 predicted 2140
6 SASI_Mm01_00163161 predicted 2756
7 SASI_Mm02_00321438 predicted 6846
8 SASI_Mm01_00163163 predicted 4484
9 SASI_Mm02_00321439 predicted 1312
10 SASI_Mm02_00321440 predicted 2314
11 SASI_Mm01_00163158 predicted 1555
12 SASI_Mm01_00163162 predicted 4558
13 SASI_Mm01_00163164 predicted 210
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005883
APC2 MISSION shRNA Bacterial Glycerol Stock
adenomatosis polyposis coli 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005883.2-3013s21c1
Sequence:CCGGGTACTGCCCACGCGAACATATCTCGAGATATGTTCGCGTGGGCAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005883.2-6183s21c1
Sequence:CCGGGGCGACAGCTAACCTTCATCACTCGAGTGATGAAGGTTAGCTGTCGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005883.2-3185s21c1
Sequence:CCGGATCAAGCTGTCGCCTACCTATCTCGAGATAGGTAGGCGACAGCTTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005883.2-657s21c1
Sequence:CCGGAGGAGAAGCTCTGGTACTACTCTCGAGAGTAGTACCAGAGCTTCTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005883.1-3468s1c1
Sequence:CCGGGACCTACAAGTGTCAGAGCAACTCGAGTTGCTCTGACACTTGTAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005883.1-6788s1c1
Sequence:CCGGGCGCCAATTCAATTGTCACGTCTCGAGACGTGACAATTGAATTGGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005883.1-2166s1c1
Sequence:CCGGGAAGCTCTGGTACTACTCTCACTCGAGTGAGAGTAGTACCAGAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005883.1-3045s1c1
Sequence:CCGGGCAGGTTGACTATGAGATGCACTCGAGTGCATCTCATAGTCAACCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005883.2-8336s1c1
Sequence:CCGGCCAGATGAGGTGAAAGCTTATCTCGAGATAAGCTTTCACCTCATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005883.1-2962s1c1
Sequence:CCGGGCTGTTATGAAGCTGTCCTTTCTCGAGAAAGGACAGCTTCATAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005883
APC2 MISSION shRNA shRNA Plasmid DNA
adenomatosis polyposis coli 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005883.2-3013s21c1
Sequence:CCGGGTACTGCCCACGCGAACATATCTCGAGATATGTTCGCGTGGGCAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005883.2-6183s21c1
Sequence:CCGGGGCGACAGCTAACCTTCATCACTCGAGTGATGAAGGTTAGCTGTCGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005883.2-3185s21c1
Sequence:CCGGATCAAGCTGTCGCCTACCTATCTCGAGATAGGTAGGCGACAGCTTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005883.2-657s21c1
Sequence:CCGGAGGAGAAGCTCTGGTACTACTCTCGAGAGTAGTACCAGAGCTTCTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005883.1-3468s1c1
Sequence:CCGGGACCTACAAGTGTCAGAGCAACTCGAGTTGCTCTGACACTTGTAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005883.1-6788s1c1
Sequence:CCGGGCGCCAATTCAATTGTCACGTCTCGAGACGTGACAATTGAATTGGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005883.1-2166s1c1
Sequence:CCGGGAAGCTCTGGTACTACTCTCACTCGAGTGAGAGTAGTACCAGAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005883.1-3045s1c1
Sequence:CCGGGCAGGTTGACTATGAGATGCACTCGAGTGCATCTCATAGTCAACCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005883.2-8336s1c1
Sequence:CCGGCCAGATGAGGTGAAAGCTTATCTCGAGATAAGCTTTCACCTCATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005883.1-2962s1c1
Sequence:CCGGGCTGTTATGAAGCTGTCCTTTCTCGAGAAAGGACAGCTTCATAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005883
APC2 MISSION shRNA Lentiviral Transduction Particles
adenomatosis polyposis coli 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005883.2-3013s21c1
Sequence:CCGGGTACTGCCCACGCGAACATATCTCGAGATATGTTCGCGTGGGCAGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005883.2-6183s21c1
Sequence:CCGGGGCGACAGCTAACCTTCATCACTCGAGTGATGAAGGTTAGCTGTCGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005883.2-3185s21c1
Sequence:CCGGATCAAGCTGTCGCCTACCTATCTCGAGATAGGTAGGCGACAGCTTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005883.2-657s21c1
Sequence:CCGGAGGAGAAGCTCTGGTACTACTCTCGAGAGTAGTACCAGAGCTTCTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005883.1-3468s1c1
Sequence:CCGGGACCTACAAGTGTCAGAGCAACTCGAGTTGCTCTGACACTTGTAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005883.1-6788s1c1
Sequence:CCGGGCGCCAATTCAATTGTCACGTCTCGAGACGTGACAATTGAATTGGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005883.1-2166s1c1
Sequence:CCGGGAAGCTCTGGTACTACTCTCACTCGAGTGAGAGTAGTACCAGAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005883.1-3045s1c1
Sequence:CCGGGCAGGTTGACTATGAGATGCACTCGAGTGCATCTCATAGTCAACCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005883.2-8336s1c1
Sequence:CCGGCCAGATGAGGTGAAAGCTTATCTCGAGATAAGCTTTCACCTCATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005883.1-2962s1c1
Sequence:CCGGGCTGTTATGAAGCTGTCCTTTCTCGAGAAAGGACAGCTTCATAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011789
APC2 MISSION shRNA Bacterial Glycerol Stock
adenomatosis polyposis coli 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011789.1-2370s1c1
Sequence:CCGGCCCAGCAGTGATGTCTATGTTCTCGAGAACATAGACATCACTGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011789.1-4891s1c1
Sequence:CCGGCCCACTGAGATAACCCAGAAACTCGAGTTTCTGGGTTATCTCAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011789.1-4892s1c1
Sequence:CCGGCCACTGAGATAACCCAGAAATCTCGAGATTTCTGGGTTATCTCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011789.1-1239s1c1
Sequence:CCGGGCTGTCATTTGACGAAGAATACTCGAGTATTCTTCGTCAAATGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011789.1-6349s1c1
Sequence:CCGGCGTCGAATCAAAGATGAAGATCTCGAGATCTTCATCTTTGATTCGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011789
APC2 MISSION shRNA shRNA Plasmid DNA
adenomatosis polyposis coli 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011789.1-2370s1c1
Sequence:CCGGCCCAGCAGTGATGTCTATGTTCTCGAGAACATAGACATCACTGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011789.1-4891s1c1
Sequence:CCGGCCCACTGAGATAACCCAGAAACTCGAGTTTCTGGGTTATCTCAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011789.1-4892s1c1
Sequence:CCGGCCACTGAGATAACCCAGAAATCTCGAGATTTCTGGGTTATCTCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011789.1-1239s1c1
Sequence:CCGGGCTGTCATTTGACGAAGAATACTCGAGTATTCTTCGTCAAATGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011789.1-6349s1c1
Sequence:CCGGCGTCGAATCAAAGATGAAGATCTCGAGATCTTCATCTTTGATTCGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011789
APC2 MISSION shRNA Lentiviral Transduction Particles
adenomatosis polyposis coli 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011789.1-2370s1c1
Sequence:CCGGCCCAGCAGTGATGTCTATGTTCTCGAGAACATAGACATCACTGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011789.1-4891s1c1
Sequence:CCGGCCCACTGAGATAACCCAGAAACTCGAGTTTCTGGGTTATCTCAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011789.1-4892s1c1
Sequence:CCGGCCACTGAGATAACCCAGAAATCTCGAGATTTCTGGGTTATCTCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011789.1-1239s1c1
Sequence:CCGGGCTGTCATTTGACGAAGAATACTCGAGTATTCTTCGTCAAATGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011789.1-6349s1c1
Sequence:CCGGCGTCGAATCAAAGATGAAGATCTCGAGATCTTCATCTTTGATTCGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)