EMAIL THIS PAGE TO A FRIEND

APC

adenomatous polyposis coli

96 Gene Product Result for
Synonyms: BTPS2 DP2 DP2.5 DP3 GS PPP1R46
UniProtKB ID: P25054, D3DT03, Q15162, Q15163, Q93042
Gene ID:
Human(324) Summary: This gene encodes a tumor suppressor protein that acts as an antagonist of the Wnt signaling pathway. It is also involved in other processes including cell migration and adhesion, transcriptional activation, and apoptosis. Defects in this gene cause familial adenomatous polyposis (FAP), an autosomal dominant pre-malignant disease that usually progresses to malignancy. Disease-associated mutations tend to be clustered in a small region designated the mutation cluster region (MCR) and result in a truncated protein product. [provided by RefSeq, Jul 2008]
Mouse(11789) adenomatosis polyposis coli
Rat(24205) adenomatous polyposis coli
sheep(101104664) adenomatous polyposis coli
domestic guinea pig(100723694) adenomatous polyposis coli
naked mole-rat(101704055) adenomatous polyposis coli
Zebrafish(386762) adenomatosis polyposis coli
fruit fly(44642) APC-like
cow(533233) adenomatous polyposis coli
Horse(100064431) adenomatous polyposis coli
domestic cat(101096138) adenomatous polyposis coli
dog(479139) adenomatous polyposis coli
chicken(415607) adenomatous polyposis coli
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Cell Lines

Product # Description Species Add to Cart
 
CLLS1069 MCF10A CELLS APC (-/-) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007462 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007462 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007462 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000038 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000038 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000038 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000038 Rosetta Predictions human pricing
NM_001127510 Rosetta Predictions human pricing
NM_001127511 Rosetta Predictions human pricing
NM_012499 Rosetta Predictions rat pricing
NM_007462 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000038 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00301724 predicted 1556
2 SASI_Hs01_00239812 predicted 5428
3 SASI_Hs01_00239813 predicted 3500
4 SASI_Hs01_00239814 predicted 5617
5 SASI_Hs02_00301725 predicted 6947
6 SASI_Hs02_00301726 predicted 2096
7 SASI_Hs01_00239815 predicted 2603
8 SASI_Hs01_00239818 predicted 2291
9 SASI_Hs02_00301727 predicted 2486
10 SASI_Hs02_00301728 predicted 1076
11 SASI_Hs01_00239816 predicted 8306
12 SASI_Hs01_00239817 predicted 1981
13 SASI_Hs01_00239819 predicted 731
14 SASI_Hs01_00239820 predicted 6210
15 SASI_Hs01_00239821 predicted 714
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127510 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329734 predicted 1664
2 SASI_Hs02_00329735 predicted 5541
3 SASI_Hs02_00329736 predicted 3607
4 SASI_Hs02_00329737 predicted 5733
5 SASI_Hs02_00329738 predicted 7058
6 SASI_Hs02_00329739 predicted 2196
7 SASI_Hs02_00329740 predicted 2709
8 SASI_Hs02_00329741 predicted 2399
9 SASI_Hs02_00329742 predicted 2599
10 SASI_Hs02_00329743 predicted 1178
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127511 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329744 predicted 1856
2 SASI_Hs02_00329745 predicted 5726
3 SASI_Hs02_00329746 predicted 3800
4 SASI_Hs02_00329747 predicted 5921
5 SASI_Hs02_00329748 predicted 7248
6 SASI_Hs02_00329749 predicted 2389
7 SASI_Hs02_00329750 predicted 2899
8 SASI_Hs02_00329751 predicted 2582
9 SASI_Hs02_00329752 predicted 2779
10 SASI_Hs02_00329753 predicted 1369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012499 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099359 predicted 5602
2 SASI_Rn01_00099360 predicted 6356
3 SASI_Rn01_00099362 predicted 6206
4 SASI_Rn01_00099363 predicted 3389
5 SASI_Rn01_00099364 predicted 2845
6 SASI_Rn02_00259548 predicted 2933
7 SASI_Rn01_00099367 predicted 290
8 SASI_Rn01_00099368 predicted 3461
9 SASI_Rn02_00259549 predicted 6999
10 SASI_Rn02_00259550 predicted 6898
11 SASI_Rn01_00099361 predicted 2411
12 SASI_Rn01_00099365 predicted 3902
13 SASI_Rn01_00099366 predicted 3036
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007462 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311654 predicted 2217
2 SASI_Mm02_00311655 predicted 6415
3 SASI_Mm02_00311656 predicted 1327
4 SASI_Mm02_00311657 predicted 6605
5 SASI_Mm02_00311658 predicted 7173
6 SASI_Mm02_00311659 predicted 4330
7 SASI_Mm02_00311660 predicted 7517
8 SASI_Mm02_00311661 predicted 5549
9 SASI_Mm02_00311662 predicted 3717
10 SASI_Mm02_00311663 predicted 8811
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007462
APC MISSION shRNA Bacterial Glycerol Stock
adenomatous polyposis coli
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007462.1-3239s1c1
Sequence:CCGGCCGATGACAAACACCTCAAATCTCGAGATTTGAGGTGTTTGTCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007462.1-1504s1c1
Sequence:CCGGGCTTTGACAAACTTGACCTTTCTCGAGAAAGGTCAAGTTTGTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007462.1-5629s1c1
Sequence:CCGGGCCGAGTTAAGAAAGGGCAAACTCGAGTTTGCCCTTTCTTAACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007462.1-4449s1c1
Sequence:CCGGCGTGGATACTTTGTTACACTTCTCGAGAAGTGTAACAAAGTATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007462.1-243s1c1
Sequence:CCGGCGGAGTGAAACTACGCTCAAACTCGAGTTTGAGCGTAGTTTCACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007462
APC MISSION shRNA shRNA Plasmid DNA
adenomatous polyposis coli
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007462.1-3239s1c1
Sequence:CCGGCCGATGACAAACACCTCAAATCTCGAGATTTGAGGTGTTTGTCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007462.1-1504s1c1
Sequence:CCGGGCTTTGACAAACTTGACCTTTCTCGAGAAAGGTCAAGTTTGTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007462.1-5629s1c1
Sequence:CCGGGCCGAGTTAAGAAAGGGCAAACTCGAGTTTGCCCTTTCTTAACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007462.1-4449s1c1
Sequence:CCGGCGTGGATACTTTGTTACACTTCTCGAGAAGTGTAACAAAGTATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007462.1-243s1c1
Sequence:CCGGCGGAGTGAAACTACGCTCAAACTCGAGTTTGAGCGTAGTTTCACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007462
APC MISSION shRNA Lentiviral Transduction Particles
adenomatous polyposis coli
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007462.1-3239s1c1
Sequence:CCGGCCGATGACAAACACCTCAAATCTCGAGATTTGAGGTGTTTGTCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007462.1-1504s1c1
Sequence:CCGGGCTTTGACAAACTTGACCTTTCTCGAGAAAGGTCAAGTTTGTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007462.1-5629s1c1
Sequence:CCGGGCCGAGTTAAGAAAGGGCAAACTCGAGTTTGCCCTTTCTTAACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007462.1-4449s1c1
Sequence:CCGGCGTGGATACTTTGTTACACTTCTCGAGAAGTGTAACAAAGTATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007462.1-243s1c1
Sequence:CCGGCGGAGTGAAACTACGCTCAAACTCGAGTTTGAGCGTAGTTTCACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000038
VALIDATED
APC MISSION shRNA Bacterial Glycerol Stock
adenomatous polyposis coli
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000038.2-9031s1c1
Sequence:CCGGGCTGTGAAATTCACAGTAATACTCGAGTATTACTGTGAATTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000038.2-4787s1c1
Sequence:CCGGGCCAACAAAGTCATCACGTAACTCGAGTTACGTGATGACTTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000038.2-6089s1c1
Sequence:CCGGCCCAGTTTGTTTCTCAAGAAACTCGAGTTTCTTGAGAAACAAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000038.2-6231s1c1
Sequence:CCGGCCCAGAAATATGGGTGGCATACTCGAGTATGCCACCCATATTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010297    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000038.x-8874s1c1
Sequence:CCGGTAATGAACACTACAGATAGAACTCGAGTTCTATCTGTAGTGTTCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000038.x-583s1c1
Sequence:CCGGCAGATATGACCAGAAGGCAATCTCGAGATTGCCTTCTGGTCATATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000038.4-1982s21c1
Sequence:CCGGGAAAGTGGAGGTGGGATATTACTCGAGTAATATCCCACCTCCACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000038.4-2292s21c1
Sequence:CCGGAGTACAAGGATGCCAATATTACTCGAGTAATATTGGCATCCTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000038.4-9652s21c1
Sequence:GTACCGGATGCGTTGGCACTTATCTATTCTCGAGAATAGATAAGTGCCAACGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000038.4-2542s21c1
Sequence:CCGGGACTGTCCTTTCACCATATTTCTCGAGAAATATGGTGAAAGGACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000038.4-3494s21c1
Sequence:CCGGGATGATAAGCCTACCAATTATCTCGAGATAATTGGTAGGCTTATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000038
VALIDATED
APC MISSION shRNA shRNA Plasmid DNA
adenomatous polyposis coli
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000038.2-9031s1c1
Sequence:CCGGGCTGTGAAATTCACAGTAATACTCGAGTATTACTGTGAATTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000038.2-4787s1c1
Sequence:CCGGGCCAACAAAGTCATCACGTAACTCGAGTTACGTGATGACTTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000038.2-6089s1c1
Sequence:CCGGCCCAGTTTGTTTCTCAAGAAACTCGAGTTTCTTGAGAAACAAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000038.2-6231s1c1
Sequence:CCGGCCCAGAAATATGGGTGGCATACTCGAGTATGCCACCCATATTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010297    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000038.x-8874s1c1
Sequence:CCGGTAATGAACACTACAGATAGAACTCGAGTTCTATCTGTAGTGTTCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000038.x-583s1c1
Sequence:CCGGCAGATATGACCAGAAGGCAATCTCGAGATTGCCTTCTGGTCATATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000038.4-1982s21c1
Sequence:CCGGGAAAGTGGAGGTGGGATATTACTCGAGTAATATCCCACCTCCACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000038.4-2292s21c1
Sequence:CCGGAGTACAAGGATGCCAATATTACTCGAGTAATATTGGCATCCTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000038.4-9652s21c1
Sequence:GTACCGGATGCGTTGGCACTTATCTATTCTCGAGAATAGATAAGTGCCAACGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000038.4-2542s21c1
Sequence:CCGGGACTGTCCTTTCACCATATTTCTCGAGAAATATGGTGAAAGGACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000038.4-3494s21c1
Sequence:CCGGGATGATAAGCCTACCAATTATCTCGAGATAATTGGTAGGCTTATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000038
VALIDATED
APC MISSION shRNA Lentiviral Transduction Particles
adenomatous polyposis coli
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000038.2-9031s1c1
Sequence:CCGGGCTGTGAAATTCACAGTAATACTCGAGTATTACTGTGAATTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000038.2-4787s1c1
Sequence:CCGGGCCAACAAAGTCATCACGTAACTCGAGTTACGTGATGACTTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000038.2-6089s1c1
Sequence:CCGGCCCAGTTTGTTTCTCAAGAAACTCGAGTTTCTTGAGAAACAAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000038.2-6231s1c1
Sequence:CCGGCCCAGAAATATGGGTGGCATACTCGAGTATGCCACCCATATTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010297    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000038.x-8874s1c1
Sequence:CCGGTAATGAACACTACAGATAGAACTCGAGTTCTATCTGTAGTGTTCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000038.x-583s1c1
Sequence:CCGGCAGATATGACCAGAAGGCAATCTCGAGATTGCCTTCTGGTCATATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000038.4-1982s21c1
Sequence:CCGGGAAAGTGGAGGTGGGATATTACTCGAGTAATATCCCACCTCCACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000038.4-2292s21c1
Sequence:CCGGAGTACAAGGATGCCAATATTACTCGAGTAATATTGGCATCCTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000038.4-9652s21c1
Sequence:GTACCGGATGCGTTGGCACTTATCTATTCTCGAGAATAGATAAGTGCCAACGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000038.4-2542s21c1
Sequence:CCGGGACTGTCCTTTCACCATATTTCTCGAGAAATATGGTGAAAGGACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000038.4-3494s21c1
Sequence:CCGGGATGATAAGCCTACCAATTATCTCGAGATAATTGGTAGGCTTATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks