EMAIL THIS PAGE TO A FRIEND

APCDD1

adenomatosis polyposis coli down-regulated 1

Synonyms: B7323 DRAPC1 HHS HTS
UniProtKB ID: Q8J025, B4DUQ0, B4DZT0, Q71M25
Gene ID:
Human(147495) Summary: This locus encodes an inhibitor of the Wnt signaling pathway. Mutations at this locus have been associated with hereditary hypotrichosis simplex. Increased expression of this gene may also be associated with colorectal carcinogenesis.[provided by RefSeq, Sep 2010]
Mouse(494504) adenomatosis polyposis coli down-regulated 1
Rat(689616) adenomatosis polyposis coli down-regulated 1
chicken(426765) adenomatosis polyposis coli down-regulated 1
domestic cat(101100092) adenomatosis polyposis coli down-regulated 1
cow(509040) adenomatosis polyposis coli down-regulated 1
Horse(100055678) adenomatosis polyposis coli down-regulated 1
dog(480209) adenomatosis polyposis coli down-regulated 1
sheep(101104951) adenomatosis polyposis coli down-regulated 1
domestic guinea pig(100734879) adenomatosis polyposis coli down-regulated 1
naked mole-rat(101719746) adenomatosis polyposis coli down-regulated 1
96 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153000 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153000 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153000 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133237 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133237 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133237 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU178631 MISSION® esiRNA esiRNA targeting mouse Apcdd1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153000 Rosetta Predictions human pricing
XM_001071384 Rosetta Predictions rat pricing
NM_133237 Rosetta Predictions mouse pricing
XM_619546 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153000 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083701 predicted 523
2 SASI_Hs01_00083702 predicted 906
3 SASI_Hs02_00366958 predicted 446
4 SASI_Hs01_00083704 predicted 2165
5 SASI_Hs01_00083705 predicted 2186
6 SASI_Hs01_00083706 predicted 649
7 SASI_Hs01_00083707 predicted 2126
8 SASI_Hs01_00083708 predicted 690
9 SASI_Hs01_00083709 predicted 1878
10 SASI_Hs02_00366959 predicted 1917
11 SASI_Hs01_00083700 predicted 2133
12 SASI_Hs01_00083703 predicted 1928
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071384 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00334917 predicted 399
2 SASI_Rn02_00334918 predicted 257
3 SASI_Rn02_00334919 predicted 742
4 SASI_Rn02_00334920 predicted 751
5 SASI_Rn02_00334921 predicted 644
6 SASI_Rn02_00334922 predicted 461
7 SASI_Rn02_00334923 predicted 692
8 SASI_Rn02_00334924 predicted 738
9 SASI_Rn02_00334925 predicted 428
10 SASI_Rn02_00334926 predicted 757
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133237 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338482 predicted 1770
2 SASI_Mm02_00338483 predicted 595
3 SASI_Mm02_00338484 predicted 1063
4 SASI_Mm02_00338485 predicted 1578
5 SASI_Mm02_00338486 predicted 1475
6 SASI_Mm02_00338487 predicted 1425
7 SASI_Mm02_00338488 predicted 886
8 SASI_Mm02_00338489 predicted 1438
9 SASI_Mm02_00338490 predicted 929
10 SASI_Mm02_00338491 predicted 1761
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_619546 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00206369 predicted 2022
2 SASI_Mm01_00206370 predicted 1851
3 SASI_Mm01_00206371 predicted 1139
4 SASI_Mm01_00206372 predicted 1665
5 SASI_Mm01_00206373 predicted 1675
6 SASI_Mm01_00206374 predicted 1557
7 SASI_Mm01_00206375 predicted 1515
8 SASI_Mm01_00206376 predicted 970
9 SASI_Mm01_00206377 predicted 1515
10 SASI_Mm01_00206378 predicted 1844
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153000
APCDD1 MISSION shRNA Bacterial Glycerol Stock
adenomatosis polyposis coli down-regulated 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137317    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153000.3-2000s1c1
Sequence:CCGGGCCAGAGAACTGTCCTTCTTTCTCGAGAAAGAAGGACAGTTCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153000.3-2343s1c1
Sequence:CCGGGCTGGAATCCAATGCAGAGTTCTCGAGAACTCTGCATTGGATTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153000.3-693s1c1
Sequence:CCGGCGGTGCACAAATCCCACTTATCTCGAGATAAGTGGGATTTGTGCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153000.3-1038s1c1
Sequence:CCGGGAGCTCTTCCTTGGTGACATTCTCGAGAATGTCACCAAGGAAGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421225    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153000.4-2156s21c1
Sequence:CCGGAGTTCTGGACGAGCGTGTTTGCTCGAGCAAACACGCTCGTCCAGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153000.4-1428s21c1
Sequence:CCGGAGGCACCGAGTTCGTGTTCAACTCGAGTTGAACACGAACTCGGTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413419    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153000.4-2188s21c1
Sequence:CCGGGAAAGCTAGGGCCTCTTATTTCTCGAGAAATAAGAGGCCCTAGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153000
APCDD1 MISSION shRNA shRNA Plasmid DNA
adenomatosis polyposis coli down-regulated 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137317    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153000.3-2000s1c1
Sequence:CCGGGCCAGAGAACTGTCCTTCTTTCTCGAGAAAGAAGGACAGTTCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153000.3-2343s1c1
Sequence:CCGGGCTGGAATCCAATGCAGAGTTCTCGAGAACTCTGCATTGGATTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153000.3-693s1c1
Sequence:CCGGCGGTGCACAAATCCCACTTATCTCGAGATAAGTGGGATTTGTGCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153000.3-1038s1c1
Sequence:CCGGGAGCTCTTCCTTGGTGACATTCTCGAGAATGTCACCAAGGAAGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421225    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153000.4-2156s21c1
Sequence:CCGGAGTTCTGGACGAGCGTGTTTGCTCGAGCAAACACGCTCGTCCAGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153000.4-1428s21c1
Sequence:CCGGAGGCACCGAGTTCGTGTTCAACTCGAGTTGAACACGAACTCGGTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413419    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153000.4-2188s21c1
Sequence:CCGGGAAAGCTAGGGCCTCTTATTTCTCGAGAAATAAGAGGCCCTAGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153000
APCDD1 MISSION shRNA Lentiviral Transduction Particles
adenomatosis polyposis coli down-regulated 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137317    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153000.3-2000s1c1
Sequence:CCGGGCCAGAGAACTGTCCTTCTTTCTCGAGAAAGAAGGACAGTTCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153000.3-2343s1c1
Sequence:CCGGGCTGGAATCCAATGCAGAGTTCTCGAGAACTCTGCATTGGATTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153000.3-693s1c1
Sequence:CCGGCGGTGCACAAATCCCACTTATCTCGAGATAAGTGGGATTTGTGCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153000.3-1038s1c1
Sequence:CCGGGAGCTCTTCCTTGGTGACATTCTCGAGAATGTCACCAAGGAAGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421225    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153000.4-2156s21c1
Sequence:CCGGAGTTCTGGACGAGCGTGTTTGCTCGAGCAAACACGCTCGTCCAGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153000.4-1428s21c1
Sequence:CCGGAGGCACCGAGTTCGTGTTCAACTCGAGTTGAACACGAACTCGGTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413419    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153000.4-2188s21c1
Sequence:CCGGGAAAGCTAGGGCCTCTTATTTCTCGAGAAATAAGAGGCCCTAGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133237
VALIDATED
APCDD1 MISSION shRNA Bacterial Glycerol Stock
adenomatosis polyposis coli down-regulated 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133237.3-1294s21c1
Sequence:CCGGCAACACCTGGGAAGGGCATTACTCGAGTAATGCCCTTCCCAGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133237.3-1537s21c1
Sequence:CCGGCCAACAGGATGTGACACATACCTCGAGGTATGTGTCACATCCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255141    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133237.3-1899s21c1
Sequence:CCGGCAAGACTCTTTACCGTGTATGCTCGAGCATACACGGTAAAGAGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133237.3-620s21c1
Sequence:CCGGTACAGGTTCTACAACAATAATCTCGAGATTATTGTTGTAGAACCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133237.3-1128s21c1
Sequence:CCGGGCATAGCCTGCCGCATCATTTCTCGAGAAATGATGCGGCAGGCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133237
VALIDATED
APCDD1 MISSION shRNA shRNA Plasmid DNA
adenomatosis polyposis coli down-regulated 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133237.3-1294s21c1
Sequence:CCGGCAACACCTGGGAAGGGCATTACTCGAGTAATGCCCTTCCCAGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133237.3-1537s21c1
Sequence:CCGGCCAACAGGATGTGACACATACCTCGAGGTATGTGTCACATCCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255141    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133237.3-1899s21c1
Sequence:CCGGCAAGACTCTTTACCGTGTATGCTCGAGCATACACGGTAAAGAGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133237.3-620s21c1
Sequence:CCGGTACAGGTTCTACAACAATAATCTCGAGATTATTGTTGTAGAACCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133237.3-1128s21c1
Sequence:CCGGGCATAGCCTGCCGCATCATTTCTCGAGAAATGATGCGGCAGGCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133237
VALIDATED
APCDD1 MISSION shRNA Lentiviral Transduction Particles
adenomatosis polyposis coli down-regulated 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133237.3-1294s21c1
Sequence:CCGGCAACACCTGGGAAGGGCATTACTCGAGTAATGCCCTTCCCAGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133237.3-1537s21c1
Sequence:CCGGCCAACAGGATGTGACACATACCTCGAGGTATGTGTCACATCCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255141    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133237.3-1899s21c1
Sequence:CCGGCAAGACTCTTTACCGTGTATGCTCGAGCATACACGGTAAAGAGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133237.3-620s21c1
Sequence:CCGGTACAGGTTCTACAACAATAATCTCGAGATTATTGTTGTAGAACCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133237.3-1128s21c1
Sequence:CCGGGCATAGCCTGCCGCATCATTTCTCGAGAAATGATGCGGCAGGCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks