EMAIL THIS PAGE TO A FRIEND

APCDD1L

adenomatosis polyposis coli down-regulated 1-like

38 Gene Product Result for
UniProtKB ID: Q8NCL9
Gene ID:
Rat(499949) adenomatosis polyposis coli down-regulated 1-like
naked mole-rat(101706936) adenomatosis polyposis coli down-regulated 1-like
domestic guinea pig(100712690) adenomatosis polyposis coli down-regulated 1-like
sheep(101102919) adenomatosis polyposis coli down-regulated 1-like
chicken(419316) adenomatosis polyposis coli down-regulated 1-like
dog(611907) adenomatosis polyposis coli down-regulated 1-like
cow(617376) adenomatosis polyposis coli down-regulated 1-like
domestic cat(101091929) adenomatosis polyposis coli down-regulated 1-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153360 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153360 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153360 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU101791 MISSION® esiRNA esiRNA human APCDD1L (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153360 Rosetta Predictions human pricing
NM_001024315 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153360 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073511 predicted 1348
2 SASI_Hs02_00367227 predicted 1446
3 SASI_Hs01_00073512 predicted 1402
4 SASI_Hs01_00073513 predicted 1120
5 SASI_Hs01_00073514 predicted 339
6 SASI_Hs01_00073520 predicted 951
7 SASI_Hs01_00073515 predicted 2132
8 SASI_Hs01_00073516 predicted 2142
9 SASI_Hs01_00073517 predicted 337
10 SASI_Hs01_00073518 predicted 1674
11 SASI_Hs01_00073519 predicted 1759
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024315 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106487 predicted 362
2 SASI_Rn02_00202526 predicted 408
3 SASI_Rn01_00106489 predicted 1786
4 SASI_Rn01_00106490 predicted 1229
5 SASI_Rn01_00106491 predicted 567
6 SASI_Rn01_00106493 predicted 1627
7 SASI_Rn01_00106494 predicted 1638
8 SASI_Rn01_00106495 predicted 1533
9 SASI_Rn01_00106496 predicted 1777
10 SASI_Rn02_00202527 predicted 1777
11 SASI_Rn01_00106488 predicted 979
12 SASI_Rn01_00106492 predicted 1528
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153360
APCDD1L MISSION shRNA Bacterial Glycerol Stock
adenomatosis polyposis coli down-regulated 1-like
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000441572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153360.1-439s21c1
Sequence:CCGGTTTCGAGCCCACCAGTTCTACCTCGAGGTAGAACTGGTGGGCTCGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153360.1-1110s21c1
Sequence:CCGGCCGCTCCTGGGAAGGGTATTACTCGAGTAATACCCTTCCCAGGAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153360.1-1687s21c1
Sequence:CCGGCTATGACATTGGACTTGACATCTCGAGATGTCAAGTCCAATGTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165676    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153360.1-1120s1c1
Sequence:CCGGGAAGGGTATTACCACCACTTCCTCGAGGAAGTGGTGGTAATACCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158750    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153360.1-2551s1c1
Sequence:CCGGGCCTTCTGAACATAGTTAATACTCGAGTATTAACTATGTTCAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161405    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153360.1-1940s1c1
Sequence:CCGGGCTACGTGAGTTTCTAAAGATCTCGAGATCTTTAGAAACTCACGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161879    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153360.1-1949s1c1
Sequence:CCGGGTTTCTAAAGATCACTCCCAACTCGAGTTGGGAGTGATCTTTAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163662    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153360.1-1125s1c1
Sequence:CCGGGTATTACCACCACTTCTCAGACTCGAGTCTGAGAAGTGGTGGTAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164257    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153360.1-2143s1c1
Sequence:CCGGCCATGTCTGTAGGTTGTTGTTCTCGAGAACAACAACCTACAGACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164879    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153360.1-2866s1c1
Sequence:CCGGGCCTCATCTGTACACTGTGAACTCGAGTTCACAGTGTACAGATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164289    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153360.1-2361s1c1
Sequence:CCGGCCAACACTGCATGTGGATAAACTCGAGTTTATCCACATGCAGTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153360
APCDD1L MISSION shRNA shRNA Plasmid DNA
adenomatosis polyposis coli down-regulated 1-like
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000441572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153360.1-439s21c1
Sequence:CCGGTTTCGAGCCCACCAGTTCTACCTCGAGGTAGAACTGGTGGGCTCGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153360.1-1110s21c1
Sequence:CCGGCCGCTCCTGGGAAGGGTATTACTCGAGTAATACCCTTCCCAGGAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153360.1-1687s21c1
Sequence:CCGGCTATGACATTGGACTTGACATCTCGAGATGTCAAGTCCAATGTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165676    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153360.1-1120s1c1
Sequence:CCGGGAAGGGTATTACCACCACTTCCTCGAGGAAGTGGTGGTAATACCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158750    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153360.1-2551s1c1
Sequence:CCGGGCCTTCTGAACATAGTTAATACTCGAGTATTAACTATGTTCAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161405    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153360.1-1940s1c1
Sequence:CCGGGCTACGTGAGTTTCTAAAGATCTCGAGATCTTTAGAAACTCACGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161879    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153360.1-1949s1c1
Sequence:CCGGGTTTCTAAAGATCACTCCCAACTCGAGTTGGGAGTGATCTTTAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163662    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153360.1-1125s1c1
Sequence:CCGGGTATTACCACCACTTCTCAGACTCGAGTCTGAGAAGTGGTGGTAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164257    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153360.1-2143s1c1
Sequence:CCGGCCATGTCTGTAGGTTGTTGTTCTCGAGAACAACAACCTACAGACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164879    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153360.1-2866s1c1
Sequence:CCGGGCCTCATCTGTACACTGTGAACTCGAGTTCACAGTGTACAGATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164289    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153360.1-2361s1c1
Sequence:CCGGCCAACACTGCATGTGGATAAACTCGAGTTTATCCACATGCAGTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153360
APCDD1L MISSION shRNA Lentiviral Transduction Particles
adenomatosis polyposis coli down-regulated 1-like
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000441572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153360.1-439s21c1
Sequence:CCGGTTTCGAGCCCACCAGTTCTACCTCGAGGTAGAACTGGTGGGCTCGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153360.1-1110s21c1
Sequence:CCGGCCGCTCCTGGGAAGGGTATTACTCGAGTAATACCCTTCCCAGGAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153360.1-1687s21c1
Sequence:CCGGCTATGACATTGGACTTGACATCTCGAGATGTCAAGTCCAATGTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165676    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153360.1-1120s1c1
Sequence:CCGGGAAGGGTATTACCACCACTTCCTCGAGGAAGTGGTGGTAATACCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158750    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153360.1-2551s1c1
Sequence:CCGGGCCTTCTGAACATAGTTAATACTCGAGTATTAACTATGTTCAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161405    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153360.1-1940s1c1
Sequence:CCGGGCTACGTGAGTTTCTAAAGATCTCGAGATCTTTAGAAACTCACGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161879    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153360.1-1949s1c1
Sequence:CCGGGTTTCTAAAGATCACTCCCAACTCGAGTTGGGAGTGATCTTTAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163662    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153360.1-1125s1c1
Sequence:CCGGGTATTACCACCACTTCTCAGACTCGAGTCTGAGAAGTGGTGGTAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164257    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153360.1-2143s1c1
Sequence:CCGGCCATGTCTGTAGGTTGTTGTTCTCGAGAACAACAACCTACAGACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164879    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153360.1-2866s1c1
Sequence:CCGGGCCTCATCTGTACACTGTGAACTCGAGTTCACAGTGTACAGATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164289    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153360.1-2361s1c1
Sequence:CCGGCCAACACTGCATGTGGATAAACTCGAGTTTATCCACATGCAGTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks