EMAIL THIS PAGE TO A FRIEND

APCS

amyloid P component, serum

59 Gene Product Result for
Synonyms: PTX2 SAP
UniProtKB ID: P02743
Gene ID:
Human(325) Summary: The protein encoded by this gene is a glycoprotein, belonging to the pentraxin family of proteins, which has a characteristic pentameric organization. These family members have considerable sequence homology which is thought to be the result of gene duplication. The binding of the encoded protein to proteins in the pathological amyloid cross-beta fold suggests its possible role as a chaperone. This protein is also thought to control the degradation of chromatin. It has been demonstrated that this protein binds to apoptotic cells at an early stage, which raises the possibility that it is involved in dealing with apoptotic cells in vivo. [provided by RefSeq, Sep 2008]
Mouse(20219) serum amyloid P-component
Rat(29339) amyloid P component, serum
domestic cat(101093332) amyloid P component, serum
dog(100684997) amyloid P component, serum
cow(514488) amyloid P component, serum
sheep(101114738) amyloid P component, serum
domestic guinea pig(100726823) amyloid P component, serum
naked mole-rat(101698681) amyloid P component, serum
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001639 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001639 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001639 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011318 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011318 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011318 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU015021 MISSION® esiRNA esiRNA targeting human APCS (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001639 Rosetta Predictions human pricing
NM_017170 Rosetta Predictions rat pricing
NM_011318 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001639 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143230 predicted 514
2 SASI_Hs01_00143233 predicted 658
3 SASI_Hs01_00143236 predicted 515
4 SASI_Hs02_00332229 predicted 195
5 SASI_Hs01_00143231 predicted 282
6 SASI_Hs02_00332230 predicted 594
7 SASI_Hs01_00143234 predicted 365
8 SASI_Hs01_00143237 predicted 349
9 SASI_Hs01_00143238 predicted 345
10 SASI_Hs01_00143239 predicted 365
11 SASI_Hs01_00143232 predicted 363
12 SASI_Hs01_00143235 predicted 384
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017170 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261493 predicted 255
2 SASI_Rn02_00261494 predicted 432
3 SASI_Rn02_00261495 predicted 268
4 SASI_Rn02_00261496 predicted 239
5 SASI_Rn02_00261497 predicted 415
6 SASI_Rn01_00030981 predicted 359
7 SASI_Rn02_00261498 predicted 230
8 SASI_Rn01_00030984 predicted 384
9 SASI_Rn01_00030985 predicted 460
10 SASI_Rn02_00261499 predicted 258
11 SASI_Rn01_00030978 predicted 345
12 SASI_Rn01_00030979 predicted 580
13 SASI_Rn01_00030980 predicted 658
14 SASI_Rn01_00030982 predicted 262
15 SASI_Rn01_00030983 predicted 592
16 SASI_Rn01_00030986 predicted 265
17 SASI_Rn01_00030987 predicted 607
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011318 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023217 predicted 709
2 SASI_Mm01_00023218 predicted 368
3 SASI_Mm01_00023219 predicted 484
4 SASI_Mm01_00023220 predicted 340
5 SASI_Mm01_00023221 predicted 262
6 SASI_Mm01_00023222 predicted 650
7 SASI_Mm01_00023223 predicted 470
8 SASI_Mm01_00023224 predicted 334
9 SASI_Mm01_00023225 predicted 652
10 SASI_Mm01_00023226 predicted 675
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001639
APCS MISSION shRNA Bacterial Glycerol Stock
amyloid P component, serum
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118977    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001639.2-772s1c1
Sequence:CCGGCTTGACTCAACGAGAGCACTTCTCGAGAAGTGCTCTCGTTGAGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001639.2-708s1c1
Sequence:CCGGGCAGGCTCTGAACTATGAAATCTCGAGATTTCATAGTTCAGAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001639.2-187s1c1
Sequence:CCGGCCTAGAGAATCTGTTACTGATCTCGAGATCAGTAACAGATTCTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001639.2-357s1c1
Sequence:CCGGTGGAGAGTATAGTCTATACATCTCGAGATGTATAGACTATACTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001639.2-354s1c1
Sequence:CCGGAGTTGGAGAGTATAGTCTATACTCGAGTATAGACTATACTCTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001639.3-446s21c1
Sequence:CCGGGGGAGTCCTCATCAGGTATTGCTCGAGCAATACCTGATGAGGACTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001639.3-311s21c1
Sequence:CCGGATACCCAAGGCAGGGATAATGCTCGAGCATTATCCCTGCCTTGGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001639.3-506s21c1
Sequence:CCGGGTCTGCGACAGGGTTACTTTGCTCGAGCAAAGTAACCCTGTCGCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001639
APCS MISSION shRNA shRNA Plasmid DNA
amyloid P component, serum
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118977    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001639.2-772s1c1
Sequence:CCGGCTTGACTCAACGAGAGCACTTCTCGAGAAGTGCTCTCGTTGAGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001639.2-708s1c1
Sequence:CCGGGCAGGCTCTGAACTATGAAATCTCGAGATTTCATAGTTCAGAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001639.2-187s1c1
Sequence:CCGGCCTAGAGAATCTGTTACTGATCTCGAGATCAGTAACAGATTCTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001639.2-357s1c1
Sequence:CCGGTGGAGAGTATAGTCTATACATCTCGAGATGTATAGACTATACTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001639.2-354s1c1
Sequence:CCGGAGTTGGAGAGTATAGTCTATACTCGAGTATAGACTATACTCTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001639.3-446s21c1
Sequence:CCGGGGGAGTCCTCATCAGGTATTGCTCGAGCAATACCTGATGAGGACTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001639.3-311s21c1
Sequence:CCGGATACCCAAGGCAGGGATAATGCTCGAGCATTATCCCTGCCTTGGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001639.3-506s21c1
Sequence:CCGGGTCTGCGACAGGGTTACTTTGCTCGAGCAAAGTAACCCTGTCGCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001639
APCS MISSION shRNA Lentiviral Transduction Particles
amyloid P component, serum
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118977    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001639.2-772s1c1
Sequence:CCGGCTTGACTCAACGAGAGCACTTCTCGAGAAGTGCTCTCGTTGAGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001639.2-708s1c1
Sequence:CCGGGCAGGCTCTGAACTATGAAATCTCGAGATTTCATAGTTCAGAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001639.2-187s1c1
Sequence:CCGGCCTAGAGAATCTGTTACTGATCTCGAGATCAGTAACAGATTCTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001639.2-357s1c1
Sequence:CCGGTGGAGAGTATAGTCTATACATCTCGAGATGTATAGACTATACTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001639.2-354s1c1
Sequence:CCGGAGTTGGAGAGTATAGTCTATACTCGAGTATAGACTATACTCTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001639.3-446s21c1
Sequence:CCGGGGGAGTCCTCATCAGGTATTGCTCGAGCAATACCTGATGAGGACTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001639.3-311s21c1
Sequence:CCGGATACCCAAGGCAGGGATAATGCTCGAGCATTATCCCTGCCTTGGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001639.3-506s21c1
Sequence:CCGGGTCTGCGACAGGGTTACTTTGCTCGAGCAAAGTAACCCTGTCGCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011318
APCS MISSION shRNA Bacterial Glycerol Stock
amyloid P component, serum
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011318.1-771s1c1
Sequence:CCGGGCAGGCTCTTAACTATGAAATCTCGAGATTTCATAGTTAAGAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011318.1-432s1c1
Sequence:CCGGCCTATACATCGGACAATCAAACTCGAGTTTGATTGTCCGATGTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011318.1-223s1c1
Sequence:CCGGGACCTCAAGAGGAAAGTATTTCTCGAGAAATACTTTCCTCTTGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011318.1-431s1c1
Sequence:CCGGGCCTATACATCGGACAATCAACTCGAGTTGATTGTCCGATGTATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011318.1-383s1c1
Sequence:CCGGGCAGAGACAATGAGCTACTAACTCGAGTTAGTAGCTCATTGTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011318
APCS MISSION shRNA shRNA Plasmid DNA
amyloid P component, serum
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011318.1-771s1c1
Sequence:CCGGGCAGGCTCTTAACTATGAAATCTCGAGATTTCATAGTTAAGAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011318.1-432s1c1
Sequence:CCGGCCTATACATCGGACAATCAAACTCGAGTTTGATTGTCCGATGTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011318.1-223s1c1
Sequence:CCGGGACCTCAAGAGGAAAGTATTTCTCGAGAAATACTTTCCTCTTGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011318.1-431s1c1
Sequence:CCGGGCCTATACATCGGACAATCAACTCGAGTTGATTGTCCGATGTATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011318.1-383s1c1
Sequence:CCGGGCAGAGACAATGAGCTACTAACTCGAGTTAGTAGCTCATTGTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011318
APCS MISSION shRNA Lentiviral Transduction Particles
amyloid P component, serum
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011318.1-771s1c1
Sequence:CCGGGCAGGCTCTTAACTATGAAATCTCGAGATTTCATAGTTAAGAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011318.1-432s1c1
Sequence:CCGGCCTATACATCGGACAATCAAACTCGAGTTTGATTGTCCGATGTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011318.1-223s1c1
Sequence:CCGGGACCTCAAGAGGAAAGTATTTCTCGAGAAATACTTTCCTCTTGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011318.1-431s1c1
Sequence:CCGGGCCTATACATCGGACAATCAACTCGAGTTGATTGTCCGATGTATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011318.1-383s1c1
Sequence:CCGGGCAGAGACAATGAGCTACTAACTCGAGTTAGTAGCTCATTGTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks