EMAIL THIS PAGE TO A FRIEND

APEH

acylaminoacyl-peptide hydrolase

63 Gene Product Result for
Synonyms: AARE ACPH APH D3F15S2 D3S48E DNF15S2 OPH
UniProtKB ID: P13798, Q9BQ33, Q9P0Y2
Gene ID:
Human(327) Summary: This gene encodes the enzyme acylpeptide hydrolase, which catalyzes the hydrolysis of the terminal acetylated amino acid preferentially from small acetylated peptides. The acetyl amino acid formed by this hydrolase is further processed to acetate and a free amino acid by an aminoacylase. This gene is located within the same region of chromosome 3 (3p21) as the aminoacylase gene, and deletions at this locus are also associated with a decrease in aminoacylase activity. The acylpeptide hydrolase is a homotetrameric protein of 300 kDa with each subunit consisting of 732 amino acid residues. It can play an important role in destroying oxidatively damaged proteins in living cells. Deletions of this gene locus are found in various types of carcinomas, including small cell lung carcinoma and renal cell carcinoma. [provided by RefSeq, Jul 2008]
Mouse(235606) acylpeptide hydrolase
Rat(24206) acylaminoacyl-peptide hydrolase
domestic guinea pig(100730493) acylaminoacyl-peptide hydrolase
naked mole-rat(101715825) acylaminoacyl-peptide hydrolase
sheep(101103273) N-acylaminoacyl-peptide hydrolase
Domestic Rabbit(100354109) N-acylaminoacyl-peptide hydrolase
Zebrafish(321028) acylpeptide hydrolase
chicken(415926) N-acylaminoacyl-peptide hydrolase
domestic cat(101085867) N-acylaminoacyl-peptide hydrolase
cow(514666) N-acylaminoacyl-peptide hydrolase
Horse(100053100) N-acylaminoacyl-peptide hydrolase
dog(476622) N-acylaminoacyl-peptide hydrolase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001640 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001640 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001640 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146226 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146226 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146226 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001640 Rosetta Predictions human pricing
NM_012500 Rosetta Predictions rat pricing
NM_146226 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001640 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240856 predicted 1389
2 SASI_Hs01_00240857 predicted 810
3 SASI_Hs01_00240858 predicted 1827
4 SASI_Hs01_00240859 predicted 786
5 SASI_Hs01_00240860 predicted 1826
6 SASI_Hs01_00240861 predicted 1622
7 SASI_Hs01_00240862 predicted 2141
8 SASI_Hs01_00240863 predicted 963
9 SASI_Hs01_00240864 predicted 1988
10 SASI_Hs02_00332231 predicted 2349
11 SASI_Hs01_00240865 predicted 2054
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012500 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098089 predicted 2033
2 SASI_Rn01_00098090 predicted 833
3 SASI_Rn02_00259551 predicted 1970
4 SASI_Rn02_00259552 predicted 1984
5 SASI_Rn01_00098091 predicted 1745
6 SASI_Rn01_00098092 predicted 1959
7 SASI_Rn01_00098094 predicted 1364
8 SASI_Rn01_00098095 predicted 880
9 SASI_Rn01_00098096 predicted 814
10 SASI_Rn01_00098097 predicted 1258
11 SASI_Rn01_00098088 predicted 1991
12 SASI_Rn01_00098093 predicted 1797
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146226 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109962 predicted 1012
2 SASI_Mm01_00109963 predicted 1953
3 SASI_Mm01_00109964 predicted 1932
4 SASI_Mm01_00109965 predicted 1560
5 SASI_Mm01_00109966 predicted 520
6 SASI_Mm01_00109967 predicted 1037
7 SASI_Mm01_00109968 predicted 1750
8 SASI_Mm01_00109969 predicted 889
9 SASI_Mm01_00109970 predicted 1547
10 SASI_Mm01_00109971 predicted 1263
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001640
VALIDATED
APEH MISSION shRNA Bacterial Glycerol Stock
acylaminoacyl-peptide hydrolase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001640.3-1243s21c1
Sequence:CCGGCCTGTATTATGTGGACCTCATCTCGAGATGAGGTCCACATAATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001640.3-2120s21c1
Sequence:CCGGGAACACTTTGATGCAAGCCATCTCGAGATGGCTTGCATCAAAGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001640.3-1991s21c1
Sequence:CCGGGCGGTACTACTAGTGAACTATCTCGAGATAGTTCACTAGTAGTACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001640.3-919s21c1
Sequence:CCGGCGAGTCCTTCTTTCAGACCAACTCGAGTTGGTCTGAAAGAAGGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001640.3-1243s1c1
Sequence:CCGGCCTGTATTATGTGGACCTCATCTCGAGATGAGGTCCACATAATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001640.3-1991s1c1
Sequence:CCGGGCGGTACTACTAGTGAACTATCTCGAGATAGTTCACTAGTAGTACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001640.3-2120s1c1
Sequence:CCGGGAACACTTTGATGCAAGCCATCTCGAGATGGCTTGCATCAAAGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001640.3-580s1c1
Sequence:CCGGCATTCGATTCTGCCGCCAATACTCGAGTATTGGCGGCAGAATCGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001640.3-919s1c1
Sequence:CCGGCGAGTCCTTCTTTCAGACCAACTCGAGTTGGTCTGAAAGAAGGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001640
VALIDATED
APEH MISSION shRNA shRNA Plasmid DNA
acylaminoacyl-peptide hydrolase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001640.3-1243s21c1
Sequence:CCGGCCTGTATTATGTGGACCTCATCTCGAGATGAGGTCCACATAATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001640.3-2120s21c1
Sequence:CCGGGAACACTTTGATGCAAGCCATCTCGAGATGGCTTGCATCAAAGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001640.3-1991s21c1
Sequence:CCGGGCGGTACTACTAGTGAACTATCTCGAGATAGTTCACTAGTAGTACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001640.3-919s21c1
Sequence:CCGGCGAGTCCTTCTTTCAGACCAACTCGAGTTGGTCTGAAAGAAGGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001640.3-1243s1c1
Sequence:CCGGCCTGTATTATGTGGACCTCATCTCGAGATGAGGTCCACATAATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001640.3-1991s1c1
Sequence:CCGGGCGGTACTACTAGTGAACTATCTCGAGATAGTTCACTAGTAGTACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001640.3-2120s1c1
Sequence:CCGGGAACACTTTGATGCAAGCCATCTCGAGATGGCTTGCATCAAAGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001640.3-580s1c1
Sequence:CCGGCATTCGATTCTGCCGCCAATACTCGAGTATTGGCGGCAGAATCGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001640.3-919s1c1
Sequence:CCGGCGAGTCCTTCTTTCAGACCAACTCGAGTTGGTCTGAAAGAAGGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001640
VALIDATED
APEH MISSION shRNA Lentiviral Transduction Particles
acylaminoacyl-peptide hydrolase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001640.3-1243s21c1
Sequence:CCGGCCTGTATTATGTGGACCTCATCTCGAGATGAGGTCCACATAATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001640.3-2120s21c1
Sequence:CCGGGAACACTTTGATGCAAGCCATCTCGAGATGGCTTGCATCAAAGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001640.3-1991s21c1
Sequence:CCGGGCGGTACTACTAGTGAACTATCTCGAGATAGTTCACTAGTAGTACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001640.3-919s21c1
Sequence:CCGGCGAGTCCTTCTTTCAGACCAACTCGAGTTGGTCTGAAAGAAGGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001640.3-1243s1c1
Sequence:CCGGCCTGTATTATGTGGACCTCATCTCGAGATGAGGTCCACATAATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001640.3-1991s1c1
Sequence:CCGGGCGGTACTACTAGTGAACTATCTCGAGATAGTTCACTAGTAGTACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001640.3-2120s1c1
Sequence:CCGGGAACACTTTGATGCAAGCCATCTCGAGATGGCTTGCATCAAAGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001640.3-580s1c1
Sequence:CCGGCATTCGATTCTGCCGCCAATACTCGAGTATTGGCGGCAGAATCGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001640.3-919s1c1
Sequence:CCGGCGAGTCCTTCTTTCAGACCAACTCGAGTTGGTCTGAAAGAAGGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146226
VALIDATED
APEH MISSION shRNA Bacterial Glycerol Stock
acylaminoacyl-peptide hydrolase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146226.1-1924s1c1
Sequence:CCGGGCTGGATAAATCACCCATCAACTCGAGTTGATGGGTGATTTATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_146226.1-1430s1c1
Sequence:CCGGCCAGACCAAGAGAATGTACAACTCGAGTTGTACATTCTCTTGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_146226.1-527s1c1
Sequence:CCGGCCCAAAGCTGAGTCCTTCTTTCTCGAGAAAGAAGGACTCAGCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146226.1-1562s1c1
Sequence:CCGGGCAGTACTACTGGTGAACTATCTCGAGATAGTTCACCAGTAGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_146226.1-1012s1c1
Sequence:CCGGCCTGTATGACTGGTACACCAACTCGAGTTGGTGTACCAGTCATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146226
VALIDATED
APEH MISSION shRNA shRNA Plasmid DNA
acylaminoacyl-peptide hydrolase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146226.1-1924s1c1
Sequence:CCGGGCTGGATAAATCACCCATCAACTCGAGTTGATGGGTGATTTATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_146226.1-1430s1c1
Sequence:CCGGCCAGACCAAGAGAATGTACAACTCGAGTTGTACATTCTCTTGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_146226.1-527s1c1
Sequence:CCGGCCCAAAGCTGAGTCCTTCTTTCTCGAGAAAGAAGGACTCAGCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146226.1-1562s1c1
Sequence:CCGGGCAGTACTACTGGTGAACTATCTCGAGATAGTTCACCAGTAGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_146226.1-1012s1c1
Sequence:CCGGCCTGTATGACTGGTACACCAACTCGAGTTGGTGTACCAGTCATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146226
VALIDATED
APEH MISSION shRNA Lentiviral Transduction Particles
acylaminoacyl-peptide hydrolase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146226.1-1924s1c1
Sequence:CCGGGCTGGATAAATCACCCATCAACTCGAGTTGATGGGTGATTTATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_146226.1-1430s1c1
Sequence:CCGGCCAGACCAAGAGAATGTACAACTCGAGTTGTACATTCTCTTGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_146226.1-527s1c1
Sequence:CCGGCCCAAAGCTGAGTCCTTCTTTCTCGAGAAAGAAGGACTCAGCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146226.1-1562s1c1
Sequence:CCGGGCAGTACTACTGGTGAACTATCTCGAGATAGTTCACCAGTAGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_146226.1-1012s1c1
Sequence:CCGGCCTGTATGACTGGTACACCAACTCGAGTTGGTGTACCAGTCATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks