EMAIL THIS PAGE TO A FRIEND

APEX1

APEX nuclease (multifunctional DNA repair enzyme) 1

93 Gene Product Result for
Synonyms: APE APE1 APEN APEX APX HAP1 REF1
UniProtKB ID: P27695, Q969L5, Q99775
Gene ID:
Human(328) Summary: Apurinic/apyrimidinic (AP) sites occur frequently in DNA molecules by spontaneous hydrolysis, by DNA damaging agents or by DNA glycosylases that remove specific abnormal bases. AP sites are pre-mutagenic lesions that can prevent normal DNA replication so the cell contains systems to identify and repair such sites. Class II AP endonucleases cleave the phosphodiester backbone 5' to the AP site. This gene encodes the major AP endonuclease in human cells. Splice variants have been found for this gene; all encode the same protein. [provided by RefSeq, Jul 2008]
Mouse(11792) apurinic/apyrimidinic endonuclease 1
Rat(79116) APEX nuclease (multifunctional DNA repair enzyme) 1
Zebrafish(406730) APEX nuclease (multifunctional DNA repair enzyme) 1
cow(281630) APEX nuclease (multifunctional DNA repair enzyme) 1
domestic cat(101101318) APEX nuclease (multifunctional DNA repair enzyme) 1
dog(482558) APEX nuclease (multifunctional DNA repair enzyme) 1
chicken(100431102) APEX nuclease (multifunctional DNA repair enzyme) 1
Goat(100860967) APEX nuclease (multifunctional DNA repair enzyme) 1
sheep(101115462) APEX nuclease (multifunctional DNA repair enzyme) 1
naked mole-rat(101709711) APEX nuclease (multifunctional DNA repair enzyme) 1
domestic guinea pig(100719062) APEX nuclease (multifunctional DNA repair enzyme) 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
A2105 Anti-AP Endonuclease antibody, Mouse monoclonal clone APEREF, purified from hybridoma cell culture rat, human, canine, mouse
ELISA, immunocytochemistry, microarray, western blot pricing
SAB2500075 Anti-APE1/APEX1 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
AV32651 Anti-APEX1 (AB1) antibody produced in rabbit IgG fraction of antiserum guinea pig, mouse, rabbit, rat, horse, bovine, human, canine, pig
immunohistochemistry, western blot pricing
AV37013 Anti-APEX1 (AB2) antibody produced in rabbit IgG fraction of antiserum rat, guinea pig, horse, rabbit, bovine, mouse, pig
western blot pricing
AV37014 Anti-APEX1 (AB3) antibody produced in rabbit IgG fraction of antiserum bovine, mouse, rabbit, horse, human, pig, rat, guinea pig, canine
western blot pricing
SAB1405468 Anti-APEX1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA002564 Anti-APEX1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, human, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB4501447 Anti-APEX1 antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
HPA000956 Anti-APEX1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB2106182 Anti-APEX1, (N-terminal) antibody produced in rabbit affinity isolated antibody human
western blot pricing
WH0000328M2 Monoclonal Anti-APEX1 antibody produced in mouse clone 4D1, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1403556 Monoclonal Anti-APEX1 antibody produced in mouse clone 3E12, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080649 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080649 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080649 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009687 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009687 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009687 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001641 Rosetta Predictions human pricing
NM_080648 Rosetta Predictions human pricing
NM_080649 Rosetta Predictions human pricing
NM_024148 Rosetta Predictions rat pricing
NM_009687 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001641 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122789 predicted 956
2 SASI_Hs01_00122790 predicted 901
3 SASI_Hs02_00332232 predicted 962
4 SASI_Hs02_00332233 predicted 1193
5 SASI_Hs01_00122791 predicted 1201
6 SASI_Hs01_00122792 predicted 892
7 SASI_Hs01_00122793 predicted 1162
8 SASI_Hs01_00122794 predicted 900
9 SASI_Hs01_00122795 predicted 952
10 SASI_Hs01_00122796 predicted 833
11 SASI_Hs01_00122788 predicted 832
12 SASI_Hs01_00122797 predicted 1146
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080648 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362390 predicted 889
2 SASI_Hs01_00027149 predicted 829
3 SASI_Hs01_00027150 predicted 898
4 SASI_Hs01_00027151 predicted 1129
5 SASI_Hs02_00362391 predicted 1127
6 SASI_Hs02_00362392 predicted 822
7 SASI_Hs01_00027154 predicted 1088
8 SASI_Hs01_00027155 predicted 829
9 SASI_Hs02_00362393 predicted 889
10 SASI_Hs02_00362394 predicted 764
11 SASI_Hs01_00027146 predicted 484
12 SASI_Hs01_00027147 predicted 435
13 SASI_Hs01_00027148 predicted 596
14 SASI_Hs01_00027152 predicted 450
15 SASI_Hs01_00027153 predicted 684
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080649 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101988 predicted 899
2 SASI_Hs01_00101989 predicted 844
3 SASI_Hs02_00362395 predicted 900
4 SASI_Hs02_00362396 predicted 1133
5 SASI_Hs01_00101990 predicted 1137
6 SASI_Hs01_00101991 predicted 831
7 SASI_Hs01_00101992 predicted 1107
8 SASI_Hs01_00101993 predicted 842
9 SASI_Hs01_00101994 predicted 903
10 SASI_Hs01_00101995 predicted 769
11 SASI_Hs01_00101987 predicted 774
12 SASI_Hs01_00101996 predicted 1089
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024148 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032861 predicted 271
2 SASI_Rn01_00032862 predicted 386
3 SASI_Rn01_00032863 predicted 883
4 SASI_Rn01_00032864 predicted 933
5 SASI_Rn01_00032865 predicted 676
6 SASI_Rn01_00032866 predicted 475
7 SASI_Rn01_00032867 predicted 521
8 SASI_Rn01_00032868 predicted 575
9 SASI_Rn01_00032870 predicted 235
10 SASI_Rn02_00263877 predicted 928
11 SASI_Rn01_00032869 predicted 346
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009687 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152564 predicted 959
2 SASI_Mm01_00152565 predicted 270
3 SASI_Mm01_00152567 predicted 226
4 SASI_Mm01_00152568 predicted 875
5 SASI_Mm01_00152569 predicted 838
6 SASI_Mm01_00152570 predicted 885
7 SASI_Mm01_00152571 predicted 842
8 SASI_Mm02_00316771 predicted 849
9 SASI_Mm02_00316772 predicted 592
10 SASI_Mm01_00152572 predicted 439
11 SASI_Mm01_00152566 predicted 838
12 SASI_Mm01_00152573 predicted 640
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080649
VALIDATED
APEX1 MISSION shRNA Bacterial Glycerol Stock
APEX nuclease (multifunctional DNA repair enzyme) 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_080649.1-497s1c1
Sequence:CCGGCCTGGATTAAGAAGAAAGGATCTCGAGATCCTTTCTTCTTAATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_080649.1-1305s1c1
Sequence:CCGGCAGAGAAATCTGCATTCTATTCTCGAGAATAGAATGCAGATTTCTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_080649.1-609s1c1
Sequence:CCGGGCCTGGACTCTCTCATCAATACTCGAGTATTGATGAGAGAGTCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352783    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080649.1-1305s21c1
Sequence:CCGGCAGAGAAATCTGCATTCTATTCTCGAGAATAGAATGCAGATTTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080649.1-1140s21c1
Sequence:CCGGCCACTCTCTGTTACCTGCATTCTCGAGAATGCAGGTAACAGAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080649.1-497s21c1
Sequence:CCGGCCTGGATTAAGAAGAAAGGATCTCGAGATCCTTTCTTCTTAATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080649.1-609s21c1
Sequence:CCGGGCCTGGACTCTCTCATCAATACTCGAGTATTGATGAGAGAGTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080649
VALIDATED
APEX1 MISSION shRNA shRNA Plasmid DNA
APEX nuclease (multifunctional DNA repair enzyme) 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_080649.1-497s1c1
Sequence:CCGGCCTGGATTAAGAAGAAAGGATCTCGAGATCCTTTCTTCTTAATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_080649.1-1305s1c1
Sequence:CCGGCAGAGAAATCTGCATTCTATTCTCGAGAATAGAATGCAGATTTCTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_080649.1-609s1c1
Sequence:CCGGGCCTGGACTCTCTCATCAATACTCGAGTATTGATGAGAGAGTCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352783    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080649.1-1305s21c1
Sequence:CCGGCAGAGAAATCTGCATTCTATTCTCGAGAATAGAATGCAGATTTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080649.1-1140s21c1
Sequence:CCGGCCACTCTCTGTTACCTGCATTCTCGAGAATGCAGGTAACAGAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080649.1-497s21c1
Sequence:CCGGCCTGGATTAAGAAGAAAGGATCTCGAGATCCTTTCTTCTTAATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080649.1-609s21c1
Sequence:CCGGGCCTGGACTCTCTCATCAATACTCGAGTATTGATGAGAGAGTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080649
VALIDATED
APEX1 MISSION shRNA Lentiviral Transduction Particles
APEX nuclease (multifunctional DNA repair enzyme) 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_080649.1-497s1c1
Sequence:CCGGCCTGGATTAAGAAGAAAGGATCTCGAGATCCTTTCTTCTTAATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_080649.1-1305s1c1
Sequence:CCGGCAGAGAAATCTGCATTCTATTCTCGAGAATAGAATGCAGATTTCTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_080649.1-609s1c1
Sequence:CCGGGCCTGGACTCTCTCATCAATACTCGAGTATTGATGAGAGAGTCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352783    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080649.1-1305s21c1
Sequence:CCGGCAGAGAAATCTGCATTCTATTCTCGAGAATAGAATGCAGATTTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080649.1-1140s21c1
Sequence:CCGGCCACTCTCTGTTACCTGCATTCTCGAGAATGCAGGTAACAGAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080649.1-497s21c1
Sequence:CCGGCCTGGATTAAGAAGAAAGGATCTCGAGATCCTTTCTTCTTAATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080649.1-609s21c1
Sequence:CCGGGCCTGGACTCTCTCATCAATACTCGAGTATTGATGAGAGAGTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009687
VALIDATED
APEX1 MISSION shRNA Bacterial Glycerol Stock
APEX nuclease (multifunctional DNA repair enzyme) 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055243    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009687.1-1033s1c1
Sequence:CCGGGTAGCTTCCTGCCTGGGAGATCTCGAGATCTCCCAGGCAGGAAGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009687.1-881s1c1
Sequence:CCGGCCCGCTCTAAGAATGTTGGTTCTCGAGAACCAACATTCTTAGAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009687.1-328s1c1
Sequence:CCGGCCAGATATCTTGTGCCTCCAACTCGAGTTGGAGGCACAAGATATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009687.1-529s1c1
Sequence:CCGGCGGGTGATTGTGGCTGAATTTCTCGAGAAATTCAGCCACAATCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009687.1-849s1c1
Sequence:CCGGCGCTTACACTTTCTGGACTTACTCGAGTAAGTCCAGAAAGTGTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331488    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009687.1-1033s21c1
Sequence:CCGGGTAGCTTCCTGCCTGGGAGATCTCGAGATCTCCCAGGCAGGAAGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009687.1-274s21c1
Sequence:CCGGGGGCTTCGAGCCTGGATTAAACTCGAGTTTAATCCAGGCTCGAAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009687.1-529s21c1
Sequence:CCGGCGGGTGATTGTGGCTGAATTTCTCGAGAAATTCAGCCACAATCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009687.1-297s21c1
Sequence:CCGGGAAAGGTTTGGATTGGGTAAACTCGAGTTTACCCAATCCAAACCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009687.1-849s21c1
Sequence:CCGGCGCTTACACTTTCTGGACTTACTCGAGTAAGTCCAGAAAGTGTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009687
VALIDATED
APEX1 MISSION shRNA shRNA Plasmid DNA
APEX nuclease (multifunctional DNA repair enzyme) 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055243    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009687.1-1033s1c1
Sequence:CCGGGTAGCTTCCTGCCTGGGAGATCTCGAGATCTCCCAGGCAGGAAGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009687.1-881s1c1
Sequence:CCGGCCCGCTCTAAGAATGTTGGTTCTCGAGAACCAACATTCTTAGAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009687.1-328s1c1
Sequence:CCGGCCAGATATCTTGTGCCTCCAACTCGAGTTGGAGGCACAAGATATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009687.1-529s1c1
Sequence:CCGGCGGGTGATTGTGGCTGAATTTCTCGAGAAATTCAGCCACAATCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009687.1-849s1c1
Sequence:CCGGCGCTTACACTTTCTGGACTTACTCGAGTAAGTCCAGAAAGTGTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331488    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009687.1-1033s21c1
Sequence:CCGGGTAGCTTCCTGCCTGGGAGATCTCGAGATCTCCCAGGCAGGAAGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009687.1-274s21c1
Sequence:CCGGGGGCTTCGAGCCTGGATTAAACTCGAGTTTAATCCAGGCTCGAAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009687.1-529s21c1
Sequence:CCGGCGGGTGATTGTGGCTGAATTTCTCGAGAAATTCAGCCACAATCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009687.1-297s21c1
Sequence:CCGGGAAAGGTTTGGATTGGGTAAACTCGAGTTTACCCAATCCAAACCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009687.1-849s21c1
Sequence:CCGGCGCTTACACTTTCTGGACTTACTCGAGTAAGTCCAGAAAGTGTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009687
VALIDATED
APEX1 MISSION shRNA Lentiviral Transduction Particles
APEX nuclease (multifunctional DNA repair enzyme) 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055243    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009687.1-1033s1c1
Sequence:CCGGGTAGCTTCCTGCCTGGGAGATCTCGAGATCTCCCAGGCAGGAAGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009687.1-881s1c1
Sequence:CCGGCCCGCTCTAAGAATGTTGGTTCTCGAGAACCAACATTCTTAGAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009687.1-328s1c1
Sequence:CCGGCCAGATATCTTGTGCCTCCAACTCGAGTTGGAGGCACAAGATATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009687.1-529s1c1
Sequence:CCGGCGGGTGATTGTGGCTGAATTTCTCGAGAAATTCAGCCACAATCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009687.1-849s1c1
Sequence:CCGGCGCTTACACTTTCTGGACTTACTCGAGTAAGTCCAGAAAGTGTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331488    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009687.1-1033s21c1
Sequence:CCGGGTAGCTTCCTGCCTGGGAGATCTCGAGATCTCCCAGGCAGGAAGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009687.1-274s21c1
Sequence:CCGGGGGCTTCGAGCCTGGATTAAACTCGAGTTTAATCCAGGCTCGAAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009687.1-529s21c1
Sequence:CCGGCGGGTGATTGTGGCTGAATTTCTCGAGAAATTCAGCCACAATCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009687.1-297s21c1
Sequence:CCGGGAAAGGTTTGGATTGGGTAAACTCGAGTTTACCCAATCCAAACCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009687.1-849s21c1
Sequence:CCGGCGCTTACACTTTCTGGACTTACTCGAGTAAGTCCAGAAAGTGTAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks