EMAIL THIS PAGE TO A FRIEND

APEX2

APEX nuclease (apurinic/apyrimidinic endonuclease) 2

Synonyms: APE2 APEXL2 XTH2
UniProtKB ID: Q9UBZ4, Q9Y5X7
Gene ID:
Human(27301) Summary: Apurinic/apyrimidinic (AP) sites occur frequently in DNA molecules by spontaneous hydrolysis, by DNA damaging agents or by DNA glycosylases that remove specific abnormal bases. AP sites are pre-mutagenic lesions that can prevent normal DNA replication so the cell contains systems to identify and repair such sites. Class II AP endonucleases cleave the phosphodiester backbone 5' to the AP site. This gene encodes a protein shown to have a weak class II AP endonuclease activity. Most of the encoded protein is located in the nucleus but some is also present in mitochondria. This protein may play an important role in both nuclear and mitochondrial base excision repair. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2012]
Mouse(77622) apurinic/apyrimidinic endonuclease 2
Rat(317628) APEX nuclease (apurinic/apyrimidinic endonuclease) 2
domestic guinea pig(100722391) APEX nuclease (apurinic/apyrimidinic endonuclease) 2
naked mole-rat(101701150) APEX nuclease (apurinic/apyrimidinic endonuclease) 2
sheep(101116123) APEX nuclease (apurinic/apyrimidinic endonuclease) 2
Zebrafish(393115) APEX nuclease (apurinic/apyrimidinic endonuclease) 2
dog(491499) APEX nuclease (apurinic/apyrimidinic endonuclease) 2
cow(511790) APEX nuclease (apurinic/apyrimidinic endonuclease) 2
domestic cat(101095317) APEX nuclease (apurinic/apyrimidinic endonuclease) 2
61 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029943 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029943 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029943 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014481 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014481 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014481 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU016741 MISSION® esiRNA esiRNA targeting human APEX2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014481 Rosetta Predictions human pricing
NM_001079892 Rosetta Predictions rat pricing
XM_229227 Rosetta Predictions rat pricing
NM_029943 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014481 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043780 predicted 573
2 SASI_Hs01_00043781 predicted 1414
3 SASI_Hs01_00043782 predicted 702
4 SASI_Hs01_00043783 predicted 509
5 SASI_Hs01_00043784 predicted 1090
6 SASI_Hs01_00043785 predicted 1524
7 SASI_Hs01_00043786 predicted 1396
8 SASI_Hs01_00043787 predicted 1095
9 SASI_Hs01_00043788 predicted 1082
10 SASI_Hs01_00043789 predicted 248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079892 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208229 predicted 1081
2 SASI_Rn02_00208230 predicted 1116
3 SASI_Rn02_00208231 predicted 1432
4 SASI_Rn02_00208232 predicted 1100
5 SASI_Rn02_00208233 predicted 1036
6 SASI_Rn02_00208234 predicted 636
7 SASI_Rn02_00208235 predicted 1429
8 SASI_Rn02_00208236 predicted 1324
9 SASI_Rn02_00208237 predicted 1263
10 SASI_Rn02_00208238 predicted 843
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_229227 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00187746 predicted 233
2 SASI_Rn01_00187747 predicted 239
3 SASI_Rn01_00187748 predicted 271
4 SASI_Rn01_00187749 predicted 231
5 SASI_Rn01_00187750 predicted 214
6 SASI_Rn01_00187751 predicted 244
7 SASI_Rn01_00187752 predicted 227
8 SASI_Rn01_00187753 predicted 229
9 SASI_Rn01_00187754 predicted 380
10 SASI_Rn01_00187755 predicted 396
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029943 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112454 predicted 241
2 SASI_Mm01_00112455 predicted 1109
3 SASI_Mm01_00112456 predicted 1092
4 SASI_Mm01_00112457 predicted 247
5 SASI_Mm01_00112458 predicted 906
6 SASI_Mm01_00112459 predicted 690
7 SASI_Mm01_00112460 predicted 904
8 SASI_Mm01_00112462 predicted 570
9 SASI_Mm01_00112463 predicted 1186
10 SASI_Mm02_00336241 predicted 242
11 SASI_Mm01_00112461 predicted 1543
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029943
APEX2 MISSION shRNA Bacterial Glycerol Stock
APEX nuclease (apurinic/apyrimidinic endonuclease) 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029943.1-180s21c1
Sequence:CCGGACGAGCTGGATGCTGATATTGCTCGAGCAATATCAGCATCCAGCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029943.1-513s21c1
Sequence:CCGGAGACTTTGACCCTGATCAATGCTCGAGCATTGATCAGGGTCAAAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029943.1-632s21c1
Sequence:CCGGGCTGGCAGTCACGTGATAATCCTCGAGGATTATCACGTGACTGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029943.1-1686s1c1
Sequence:CCGGCCTGCCTATGAAGGCTTCTTTCTCGAGAAAGAAGCCTTCATAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029943.1-247s1c1
Sequence:CCGGCCTGGCTATTGTTGAGGGTTACTCGAGTAACCCTCAACAATAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029943.1-321s1c1
Sequence:CCGGCCTTCTGTAAGGACAGTGCTACTCGAGTAGCACTGTCCTTACAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029943.1-693s1c1
Sequence:CCGGGCGATGCAAGTAGTCTGGAATCTCGAGATTCCAGACTACTTGCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029943
APEX2 MISSION shRNA shRNA Plasmid DNA
APEX nuclease (apurinic/apyrimidinic endonuclease) 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029943.1-180s21c1
Sequence:CCGGACGAGCTGGATGCTGATATTGCTCGAGCAATATCAGCATCCAGCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029943.1-513s21c1
Sequence:CCGGAGACTTTGACCCTGATCAATGCTCGAGCATTGATCAGGGTCAAAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029943.1-632s21c1
Sequence:CCGGGCTGGCAGTCACGTGATAATCCTCGAGGATTATCACGTGACTGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029943.1-1686s1c1
Sequence:CCGGCCTGCCTATGAAGGCTTCTTTCTCGAGAAAGAAGCCTTCATAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029943.1-247s1c1
Sequence:CCGGCCTGGCTATTGTTGAGGGTTACTCGAGTAACCCTCAACAATAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029943.1-321s1c1
Sequence:CCGGCCTTCTGTAAGGACAGTGCTACTCGAGTAGCACTGTCCTTACAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029943.1-693s1c1
Sequence:CCGGGCGATGCAAGTAGTCTGGAATCTCGAGATTCCAGACTACTTGCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029943
APEX2 MISSION shRNA Lentiviral Transduction Particles
APEX nuclease (apurinic/apyrimidinic endonuclease) 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029943.1-180s21c1
Sequence:CCGGACGAGCTGGATGCTGATATTGCTCGAGCAATATCAGCATCCAGCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029943.1-513s21c1
Sequence:CCGGAGACTTTGACCCTGATCAATGCTCGAGCATTGATCAGGGTCAAAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029943.1-632s21c1
Sequence:CCGGGCTGGCAGTCACGTGATAATCCTCGAGGATTATCACGTGACTGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029943.1-1686s1c1
Sequence:CCGGCCTGCCTATGAAGGCTTCTTTCTCGAGAAAGAAGCCTTCATAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029943.1-247s1c1
Sequence:CCGGCCTGGCTATTGTTGAGGGTTACTCGAGTAACCCTCAACAATAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029943.1-321s1c1
Sequence:CCGGCCTTCTGTAAGGACAGTGCTACTCGAGTAGCACTGTCCTTACAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029943.1-693s1c1
Sequence:CCGGGCGATGCAAGTAGTCTGGAATCTCGAGATTCCAGACTACTTGCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014481
VALIDATED
APEX2 MISSION shRNA Bacterial Glycerol Stock
APEX nuclease (apurinic/apyrimidinic endonuclease) 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049658    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_014481.2-1734s1c1
Sequence:CCGGCCTACCCTTCTCTTCCTCTTTCTCGAGAAAGAGGAAGAGAAGGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_014481.2-577s1c1
Sequence:CCGGGCTAGTCTTTAAGATGCGCTTCTCGAGAAGCGCATCTTAAAGACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_014481.2-1419s1c1
Sequence:CCGGAGAAGGAGTTACGGACCTCATCTCGAGATGAGGTCCGTAACTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_014481.2-323s1c1
Sequence:CCGGGCCACCTTCTGTAAGGACAATCTCGAGATTGTCCTTACAGAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_014481.2-594s1c1
Sequence:CCGGGCTTCTATCGTTTGCTGCAAACTCGAGTTTGCAGCAAACGATAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014481
VALIDATED
APEX2 MISSION shRNA shRNA Plasmid DNA
APEX nuclease (apurinic/apyrimidinic endonuclease) 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049658    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_014481.2-1734s1c1
Sequence:CCGGCCTACCCTTCTCTTCCTCTTTCTCGAGAAAGAGGAAGAGAAGGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_014481.2-577s1c1
Sequence:CCGGGCTAGTCTTTAAGATGCGCTTCTCGAGAAGCGCATCTTAAAGACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_014481.2-1419s1c1
Sequence:CCGGAGAAGGAGTTACGGACCTCATCTCGAGATGAGGTCCGTAACTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_014481.2-323s1c1
Sequence:CCGGGCCACCTTCTGTAAGGACAATCTCGAGATTGTCCTTACAGAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_014481.2-594s1c1
Sequence:CCGGGCTTCTATCGTTTGCTGCAAACTCGAGTTTGCAGCAAACGATAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014481
VALIDATED
APEX2 MISSION shRNA Lentiviral Transduction Particles
APEX nuclease (apurinic/apyrimidinic endonuclease) 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049658    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_014481.2-1734s1c1
Sequence:CCGGCCTACCCTTCTCTTCCTCTTTCTCGAGAAAGAGGAAGAGAAGGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_014481.2-577s1c1
Sequence:CCGGGCTAGTCTTTAAGATGCGCTTCTCGAGAAGCGCATCTTAAAGACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_014481.2-1419s1c1
Sequence:CCGGAGAAGGAGTTACGGACCTCATCTCGAGATGAGGTCCGTAACTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_014481.2-323s1c1
Sequence:CCGGGCCACCTTCTGTAAGGACAATCTCGAGATTGTCCTTACAGAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_014481.2-594s1c1
Sequence:CCGGGCTTCTATCGTTTGCTGCAAACTCGAGTTTGCAGCAAACGATAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks