EMAIL THIS PAGE TO A FRIEND

APH1A

APH1A gamma secretase subunit

194 Gene Product Result for
Synonyms: 6530402N02Rik APH-1 APH-1A CGI-78
Gene ID:
Human(51107) Summary: This gene encodes a component of the gamma secretase complex that cleaves integral membrane proteins such as Notch receptors and beta-amyloid precursor protein. The gamma secretase complex contains this gene product, or the paralogous anterior pharynx defective 1 homolog B (APH1B), along with the presenilin, nicastrin, and presenilin enhancer-2 proteins. The precise function of this seven-transmembrane-domain protein is unknown though it is suspected of facilitating the association of nicastrin and presenilin in the gamma secretase complex as well as interacting with substrates of the gamma secretase complex prior to their proteolytic processing. Polymorphisms in a promoter region of this gene have been associated with an increased risk for developing sporadic Alzheimer's disease. Alternative splicing results in multiple protein-coding and non-protein-coding transcript variants. [provided by RefSeq, Aug 2011]
Mouse(226548) anterior pharynx defective 1a homolog (C. elegans)
Rat(365872) APH1A gamma secretase subunit
chicken(769986) anterior pharynx defective 1 homolog A (C. elegans)
dog(483181) anterior pharynx defective 1 homolog A (C. elegans)
domestic cat(101083193) anterior pharynx defective 1 homolog A (C. elegans)
cow(539247) anterior pharynx defective 1 homolog A (C. elegans)
domestic guinea pig(100728852) APH1A gamma secretase subunit
naked mole-rat(101717558) APH1A gamma secretase subunit
sheep(101103438) anterior pharynx defective 1 homolog A (C. elegans)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
D5942 DAPT ≥98% (HPLC), solid human, mouse, rat pricing
L1790 L-685,458 >96% (HPLC), solid human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016022 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016022 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016022 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146104 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146104 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146104 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077628 Rosetta Predictions human pricing
NM_016022 Rosetta Predictions human pricing
NM_001014255 Rosetta Predictions rat pricing
NM_146104 Rosetta Predictions mouse pricing
NM_146134 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077628 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313034 predicted 772
2 SASI_Hs02_00313035 predicted 483
3 SASI_Hs02_00313036 predicted 652
4 SASI_Hs02_00313037 predicted 709
5 SASI_Hs02_00313038 predicted 518
6 SASI_Hs02_00313039 predicted 707
7 SASI_Hs02_00313040 predicted 679
8 SASI_Hs02_00313041 predicted 566
9 SASI_Hs02_00313042 predicted 760
10 SASI_Hs02_00313043 predicted 707
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016022 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158239 predicted 777
2 SASI_Hs01_00158240 predicted 484
3 SASI_Hs02_00348706 predicted 644
4 SASI_Hs02_00348707 predicted 706
5 SASI_Hs01_00158241 predicted 517
6 SASI_Hs02_00348708 predicted 707
7 SASI_Hs02_00348709 predicted 687
8 SASI_Hs02_00348710 predicted 566
9 SASI_Hs01_00158245 predicted 767
10 SASI_Hs02_00348711 predicted 703
11 SASI_Hs01_00158236 predicted 1053
12 SASI_Hs01_00158237 predicted 577
13 SASI_Hs01_00158238 predicted 829
14 SASI_Hs01_00158242 predicted 875
15 SASI_Hs01_00158243 predicted 997
16 SASI_Hs01_00158244 predicted 854
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014255 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065340 predicted 774
2 SASI_Rn01_00065341 predicted 520
3 SASI_Rn01_00065342 predicted 1054
4 SASI_Rn01_00065343 predicted 1057
5 SASI_Rn01_00065344 predicted 530
6 SASI_Rn01_00065345 predicted 578
7 SASI_Rn01_00065346 predicted 388
8 SASI_Rn01_00065347 predicted 1052
9 SASI_Rn01_00065348 predicted 358
10 SASI_Rn02_00201822 predicted 550
11 SASI_Rn01_00065349 predicted 590
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146104 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341746 predicted 500
2 SASI_Mm01_00158636 predicted 637
3 SASI_Mm02_00341747 predicted 663
4 SASI_Mm01_00158639 predicted 353
5 SASI_Mm01_00158640 predicted 510
6 SASI_Mm01_00158641 predicted 366
7 SASI_Mm01_00158642 predicted 337
8 SASI_Mm02_00341748 predicted 622
9 SASI_Mm02_00341749 predicted 553
10 SASI_Mm02_00341750 predicted 536
11 SASI_Mm01_00158637 predicted 1040
12 SASI_Mm01_00158638 predicted 670
13 SASI_Mm01_00158643 predicted 948
14 SASI_Mm01_00158644 predicted 956
15 SASI_Mm01_00158645 predicted 935
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146134 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341815 predicted 442
2 SASI_Mm02_00341816 predicted 580
3 SASI_Mm02_00341817 predicted 609
4 SASI_Mm02_00341818 predicted 295
5 SASI_Mm02_00341819 predicted 455
6 SASI_Mm02_00341820 predicted 309
7 SASI_Mm02_00341821 predicted 278
8 SASI_Mm02_00341822 predicted 558
9 SASI_Mm02_00341823 predicted 494
10 SASI_Mm02_00341824 predicted 471
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016022
VALIDATED
APH1A MISSION shRNA Bacterial Glycerol Stock
APH1A gamma secretase subunit
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016022.1-548s1c1
Sequence:CCGGCCATGGAGACTCACCCTATTACTCGAGTAATAGGGTGAGTCTCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016022.1-356s1c1
Sequence:CCGGGTTCCGCTTTGCCTACTACAACTCGAGTTGTAGTAGGCAAAGCGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162474    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016022.1-485s1c1
Sequence:CCGGCAGTGGTGTCTTCTCTGTTATCTCGAGATAACAGAGAAGACACCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161423    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016022.1-1663s1c1
Sequence:CCGGGAACTGGCATTACTGGAACTACTCGAGTAGTTCCAGTAATGCCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016022.1-748s1c1
Sequence:CCGGCCATCTATGCAGTCACTGTTTCTCGAGAAACAGTGACTGCATAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016022.1-559s1c1
Sequence:CCGGCACCCTATTACTTCCTGACTTCTCGAGAAGTCAGGAAGTAATAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016022.1-255s1c1
Sequence:CCGGGTCTGGTTCATCTTGGTCCATCTCGAGATGGACCAAGATGAACCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016022.2-713s21c1
Sequence:CCGGGTCTTCTCTGTTATCAATATTCTCGAGAATATTGATAACAGAGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016022.2-969s21c1
Sequence:CCGGCCATCTATGCAGTCACTGTTTCTCGAGAAACAGTGACTGCATAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_016022.2-586s21c1
Sequence:CCGGTGCCTACTACAAGCTGCTTAACTCGAGTTAAGCAGCTTGTAGTAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016022.2-770s21c1
Sequence:CCGGCATGGAGACTCACCCTATTACCTCGAGGTAATAGGGTGAGTCTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330367    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016022.2-1884s21c1
Sequence:CCGGGAACTGGCATTACTGGAACTACTCGAGTAGTTCCAGTAATGCCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016022
VALIDATED
APH1A MISSION shRNA shRNA Plasmid DNA
APH1A gamma secretase subunit
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016022.1-548s1c1
Sequence:CCGGCCATGGAGACTCACCCTATTACTCGAGTAATAGGGTGAGTCTCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016022.1-356s1c1
Sequence:CCGGGTTCCGCTTTGCCTACTACAACTCGAGTTGTAGTAGGCAAAGCGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162474    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016022.1-485s1c1
Sequence:CCGGCAGTGGTGTCTTCTCTGTTATCTCGAGATAACAGAGAAGACACCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161423    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016022.1-1663s1c1
Sequence:CCGGGAACTGGCATTACTGGAACTACTCGAGTAGTTCCAGTAATGCCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016022.1-748s1c1
Sequence:CCGGCCATCTATGCAGTCACTGTTTCTCGAGAAACAGTGACTGCATAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016022.1-559s1c1
Sequence:CCGGCACCCTATTACTTCCTGACTTCTCGAGAAGTCAGGAAGTAATAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016022.1-255s1c1
Sequence:CCGGGTCTGGTTCATCTTGGTCCATCTCGAGATGGACCAAGATGAACCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016022.2-713s21c1
Sequence:CCGGGTCTTCTCTGTTATCAATATTCTCGAGAATATTGATAACAGAGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016022.2-969s21c1
Sequence:CCGGCCATCTATGCAGTCACTGTTTCTCGAGAAACAGTGACTGCATAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_016022.2-586s21c1
Sequence:CCGGTGCCTACTACAAGCTGCTTAACTCGAGTTAAGCAGCTTGTAGTAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016022.2-770s21c1
Sequence:CCGGCATGGAGACTCACCCTATTACCTCGAGGTAATAGGGTGAGTCTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330367    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016022.2-1884s21c1
Sequence:CCGGGAACTGGCATTACTGGAACTACTCGAGTAGTTCCAGTAATGCCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016022
VALIDATED
APH1A MISSION shRNA Lentiviral Transduction Particles
APH1A gamma secretase subunit
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016022.1-548s1c1
Sequence:CCGGCCATGGAGACTCACCCTATTACTCGAGTAATAGGGTGAGTCTCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016022.1-356s1c1
Sequence:CCGGGTTCCGCTTTGCCTACTACAACTCGAGTTGTAGTAGGCAAAGCGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162474    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016022.1-485s1c1
Sequence:CCGGCAGTGGTGTCTTCTCTGTTATCTCGAGATAACAGAGAAGACACCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161423    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016022.1-1663s1c1
Sequence:CCGGGAACTGGCATTACTGGAACTACTCGAGTAGTTCCAGTAATGCCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016022.1-748s1c1
Sequence:CCGGCCATCTATGCAGTCACTGTTTCTCGAGAAACAGTGACTGCATAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016022.1-559s1c1
Sequence:CCGGCACCCTATTACTTCCTGACTTCTCGAGAAGTCAGGAAGTAATAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016022.1-255s1c1
Sequence:CCGGGTCTGGTTCATCTTGGTCCATCTCGAGATGGACCAAGATGAACCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016022.2-713s21c1
Sequence:CCGGGTCTTCTCTGTTATCAATATTCTCGAGAATATTGATAACAGAGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016022.2-969s21c1
Sequence:CCGGCCATCTATGCAGTCACTGTTTCTCGAGAAACAGTGACTGCATAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_016022.2-586s21c1
Sequence:CCGGTGCCTACTACAAGCTGCTTAACTCGAGTTAAGCAGCTTGTAGTAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016022.2-770s21c1
Sequence:CCGGCATGGAGACTCACCCTATTACCTCGAGGTAATAGGGTGAGTCTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330367    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016022.2-1884s21c1
Sequence:CCGGGAACTGGCATTACTGGAACTACTCGAGTAGTTCCAGTAATGCCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146104
VALIDATED
APH1A MISSION shRNA Bacterial Glycerol Stock
APH1A gamma secretase subunit
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113335    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146104.1-2564s1c1
Sequence:CCGGCCTGGTGTATAGAGAGGGTTACTCGAGTAACCCTCTCTATACACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146104.1-550s1c1
Sequence:CCGGCGGTATCATCAGTGGTGTCTTCTCGAGAAGACACCACTGATGATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146104.1-439s1c1
Sequence:CCGGTGCTTACTACAAGCTCCTTAACTCGAGTTAAGGAGCTTGTAGTAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146104.1-658s1c1
Sequence:CCGGCTTTCTGACAGCAGCCATTATCTCGAGATAATGGCTGCTGTCAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146104.1-347s1c1
Sequence:CCGGCATGTGACAGACCGATCAGATCTCGAGATCTGATCGGTCTGTCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146104
VALIDATED
APH1A MISSION shRNA shRNA Plasmid DNA
APH1A gamma secretase subunit
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113335    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146104.1-2564s1c1
Sequence:CCGGCCTGGTGTATAGAGAGGGTTACTCGAGTAACCCTCTCTATACACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146104.1-550s1c1
Sequence:CCGGCGGTATCATCAGTGGTGTCTTCTCGAGAAGACACCACTGATGATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146104.1-439s1c1
Sequence:CCGGTGCTTACTACAAGCTCCTTAACTCGAGTTAAGGAGCTTGTAGTAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146104.1-658s1c1
Sequence:CCGGCTTTCTGACAGCAGCCATTATCTCGAGATAATGGCTGCTGTCAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146104.1-347s1c1
Sequence:CCGGCATGTGACAGACCGATCAGATCTCGAGATCTGATCGGTCTGTCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146104
VALIDATED
APH1A MISSION shRNA Lentiviral Transduction Particles
APH1A gamma secretase subunit
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113335    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146104.1-2564s1c1
Sequence:CCGGCCTGGTGTATAGAGAGGGTTACTCGAGTAACCCTCTCTATACACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146104.1-550s1c1
Sequence:CCGGCGGTATCATCAGTGGTGTCTTCTCGAGAAGACACCACTGATGATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146104.1-439s1c1
Sequence:CCGGTGCTTACTACAAGCTCCTTAACTCGAGTTAAGGAGCTTGTAGTAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146104.1-658s1c1
Sequence:CCGGCTTTCTGACAGCAGCCATTATCTCGAGATAATGGCTGCTGTCAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146104.1-347s1c1
Sequence:CCGGCATGTGACAGACCGATCAGATCTCGAGATCTGATCGGTCTGTCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks