EMAIL THIS PAGE TO A FRIEND

APH1B

APH1B gamma secretase subunit

75 Gene Product Result for
Synonyms: APH-1B PRO1328 PSFL TAAV688
UniProtKB ID: Q8WW43, A8K589, Q564N3, Q6UWQ1, Q9H0S0
Gene ID:
Human(83464) Summary: This gene encodes a multi-pass transmembrane protein that is a functional component of the gamma-secretase complex, which also contains presenilin and nicastrin. This protein represents a stabilizing cofactor for the presenilin holoprotein in the complex. The gamma-secretase complex catalyzes the cleavage of integral proteins such as notch receptors and beta-amyloid precursor protein. [provided by RefSeq, Sep 2011]
Mouse(208117) anterior pharynx defective 1b homolog (C. elegans)
Rat(300802) anterior pharynx defective 1 homolog B (C. elegans)
sheep(101111553) anterior pharynx defective 1 homolog B (C. elegans)
naked mole-rat(101712646) APH1B gamma secretase subunit
domestic guinea pig(100718283) APH1B gamma secretase subunit
Zebrafish(386808) anterior pharynx defective 1B
dog(487589) anterior pharynx defective 1 homolog B (C. elegans)
Horse(100067205) anterior pharynx defective 1 homolog B (C. elegans)
cow(530913) anterior pharynx defective 1 homolog B (C. elegans)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2107050 Anti-APH1B antibody produced in rabbit affinity isolated antibody rabbit, horse, human, guinea pig
ELISA, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
D5942 DAPT ≥98% (HPLC), solid human, mouse, rat pricing
L1790 L-685,458 >96% (HPLC), solid human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177583 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177583 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177583 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031301 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031301 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031301 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031301 Rosetta Predictions human pricing
NM_001047090 Rosetta Predictions rat pricing
NM_177583 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031301 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066788 predicted 235
2 SASI_Hs01_00066789 predicted 279
3 SASI_Hs01_00066791 predicted 227
4 SASI_Hs01_00066792 predicted 239
5 SASI_Hs01_00066793 predicted 355
6 SASI_Hs01_00066794 predicted 631
7 SASI_Hs01_00066795 predicted 589
8 SASI_Hs01_00066796 predicted 643
9 SASI_Hs01_00066797 predicted 517
10 SASI_Hs02_00358746 predicted 398
11 SASI_Hs01_00066790 predicted 474
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047090 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205834 predicted 1025
2 SASI_Rn02_00205835 predicted 214
3 SASI_Rn02_00205836 predicted 845
4 SASI_Rn02_00205837 predicted 861
5 SASI_Rn02_00205838 predicted 318
6 SASI_Rn02_00205839 predicted 378
7 SASI_Rn02_00205840 predicted 312
8 SASI_Rn02_00205841 predicted 606
9 SASI_Rn02_00205842 predicted 684
10 SASI_Rn02_00205843 predicted 459
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177583 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173991 predicted 231
2 SASI_Mm02_00347759 predicted 111
3 SASI_Mm01_00173988 predicted 880
4 SASI_Mm01_00173989 predicted 307
5 SASI_Mm01_00173990 predicted 325
6 SASI_Mm01_00173992 predicted 874
7 SASI_Mm01_00173993 predicted 710
8 SASI_Mm01_00173994 predicted 527
9 SASI_Mm01_00173995 predicted 695
10 SASI_Mm01_00173996 predicted 909
11 SASI_Mm01_00173997 predicted 606
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177583
APH1B MISSION shRNA Bacterial Glycerol Stock
APH1B gamma secretase subunit
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000449948    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177583.4-1147s21c1
Sequence:CCGGGTTCAGTGTTGGTCTTCTAAACTCGAGTTTAGAAGACCAACACTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177583.2-113s1c1
Sequence:CCGGCGCTCTTTATGTCTTCACCATCTCGAGATGGTGAAGACATAAAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177583.2-320s1c1
Sequence:CCGGGCTCGCATATTATAAGCTGTTCTCGAGAACAGCTTATAATATGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115126    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177583.2-4140s1c1
Sequence:CCGGCCGGTGAAATTAACCATGATTCTCGAGAATCATGGTTAATTTCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177583.2-521s1c1
Sequence:CCGGGTTCTTCCTTAATTCAGCTTTCTCGAGAAAGCTGAATTAAGGAAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177583.2-524s1c1
Sequence:CCGGCTTCCTTAATTCAGCTTTCATCTCGAGATGAAAGCTGAATTAAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177583
APH1B MISSION shRNA shRNA Plasmid DNA
APH1B gamma secretase subunit
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000449948    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177583.4-1147s21c1
Sequence:CCGGGTTCAGTGTTGGTCTTCTAAACTCGAGTTTAGAAGACCAACACTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177583.2-113s1c1
Sequence:CCGGCGCTCTTTATGTCTTCACCATCTCGAGATGGTGAAGACATAAAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177583.2-320s1c1
Sequence:CCGGGCTCGCATATTATAAGCTGTTCTCGAGAACAGCTTATAATATGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115126    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177583.2-4140s1c1
Sequence:CCGGCCGGTGAAATTAACCATGATTCTCGAGAATCATGGTTAATTTCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177583.2-521s1c1
Sequence:CCGGGTTCTTCCTTAATTCAGCTTTCTCGAGAAAGCTGAATTAAGGAAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177583.2-524s1c1
Sequence:CCGGCTTCCTTAATTCAGCTTTCATCTCGAGATGAAAGCTGAATTAAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177583
APH1B MISSION shRNA Lentiviral Transduction Particles
APH1B gamma secretase subunit
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000449948    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177583.4-1147s21c1
Sequence:CCGGGTTCAGTGTTGGTCTTCTAAACTCGAGTTTAGAAGACCAACACTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177583.2-113s1c1
Sequence:CCGGCGCTCTTTATGTCTTCACCATCTCGAGATGGTGAAGACATAAAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177583.2-320s1c1
Sequence:CCGGGCTCGCATATTATAAGCTGTTCTCGAGAACAGCTTATAATATGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115126    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177583.2-4140s1c1
Sequence:CCGGCCGGTGAAATTAACCATGATTCTCGAGAATCATGGTTAATTTCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177583.2-521s1c1
Sequence:CCGGGTTCTTCCTTAATTCAGCTTTCTCGAGAAAGCTGAATTAAGGAAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177583.2-524s1c1
Sequence:CCGGCTTCCTTAATTCAGCTTTCATCTCGAGATGAAAGCTGAATTAAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031301
VALIDATED
APH1B MISSION shRNA Bacterial Glycerol Stock
APH1B gamma secretase subunit
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369942    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_031301.3-1169s21c1
Sequence:CCGGCCACTGGTTTGGTATCCAAATCTCGAGATTTGGATACCAAACCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_031301.3-327s21c1
Sequence:CCGGATGTTCCGATTTGCATATTATCTCGAGATAATATGCAAATCGGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_031301.3-234s21c1
Sequence:CCGGTTCATGGCAAGAGTCATTATTCTCGAGAATAATGACTCTTGCCATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031301.3-1058s21c1
Sequence:CCGGCAGTGTAAAGCCGACTGATTCCTCGAGGAATCAGTCGGCTTTACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_031301.3-680s21c1
Sequence:CCGGGACCTTCATAAGTTCTTATTACTCGAGTAATAAGAACTTATGAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_031301.3-300s21c1
Sequence:CCGGGCGTTTGTCTCTGTCTATATCCTCGAGGATATAGACAGAGACAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_031301.1-498s1c1
Sequence:CCGGGCTTTCATGACGCTGGTCATTCTCGAGAATGACCAGCGTCATGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_031301.1-254s1c1
Sequence:CCGGCTCTGTCTATATCCGAGAAATCTCGAGATTTCTCGGATATAGACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031301.1-662s1c1
Sequence:CCGGGTCAGCATTTATAATCCTGGTCTCGAGACCAGGATTATAAATGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_031301.1-267s1c1
Sequence:CCGGCGAGAAATGTTCCGATTTGCACTCGAGTGCAAATCGGAACATTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031301.1-416s1c1
Sequence:CCGGCTTTGTGAATACCCTATCTGACTCGAGTCAGATAGGGTATTCACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031301
VALIDATED
APH1B MISSION shRNA shRNA Plasmid DNA
APH1B gamma secretase subunit
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369942    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_031301.3-1169s21c1
Sequence:CCGGCCACTGGTTTGGTATCCAAATCTCGAGATTTGGATACCAAACCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_031301.3-327s21c1
Sequence:CCGGATGTTCCGATTTGCATATTATCTCGAGATAATATGCAAATCGGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_031301.3-234s21c1
Sequence:CCGGTTCATGGCAAGAGTCATTATTCTCGAGAATAATGACTCTTGCCATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031301.3-1058s21c1
Sequence:CCGGCAGTGTAAAGCCGACTGATTCCTCGAGGAATCAGTCGGCTTTACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_031301.3-680s21c1
Sequence:CCGGGACCTTCATAAGTTCTTATTACTCGAGTAATAAGAACTTATGAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_031301.3-300s21c1
Sequence:CCGGGCGTTTGTCTCTGTCTATATCCTCGAGGATATAGACAGAGACAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_031301.1-498s1c1
Sequence:CCGGGCTTTCATGACGCTGGTCATTCTCGAGAATGACCAGCGTCATGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_031301.1-254s1c1
Sequence:CCGGCTCTGTCTATATCCGAGAAATCTCGAGATTTCTCGGATATAGACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031301.1-662s1c1
Sequence:CCGGGTCAGCATTTATAATCCTGGTCTCGAGACCAGGATTATAAATGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_031301.1-267s1c1
Sequence:CCGGCGAGAAATGTTCCGATTTGCACTCGAGTGCAAATCGGAACATTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031301.1-416s1c1
Sequence:CCGGCTTTGTGAATACCCTATCTGACTCGAGTCAGATAGGGTATTCACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031301
VALIDATED
APH1B MISSION shRNA Lentiviral Transduction Particles
APH1B gamma secretase subunit
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369942    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_031301.3-1169s21c1
Sequence:CCGGCCACTGGTTTGGTATCCAAATCTCGAGATTTGGATACCAAACCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_031301.3-327s21c1
Sequence:CCGGATGTTCCGATTTGCATATTATCTCGAGATAATATGCAAATCGGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_031301.3-234s21c1
Sequence:CCGGTTCATGGCAAGAGTCATTATTCTCGAGAATAATGACTCTTGCCATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031301.3-1058s21c1
Sequence:CCGGCAGTGTAAAGCCGACTGATTCCTCGAGGAATCAGTCGGCTTTACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_031301.3-680s21c1
Sequence:CCGGGACCTTCATAAGTTCTTATTACTCGAGTAATAAGAACTTATGAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_031301.3-300s21c1
Sequence:CCGGGCGTTTGTCTCTGTCTATATCCTCGAGGATATAGACAGAGACAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_031301.1-498s1c1
Sequence:CCGGGCTTTCATGACGCTGGTCATTCTCGAGAATGACCAGCGTCATGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_031301.1-254s1c1
Sequence:CCGGCTCTGTCTATATCCGAGAAATCTCGAGATTTCTCGGATATAGACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031301.1-662s1c1
Sequence:CCGGGTCAGCATTTATAATCCTGGTCTCGAGACCAGGATTATAAATGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_031301.1-267s1c1
Sequence:CCGGCGAGAAATGTTCCGATTTGCACTCGAGTGCAAATCGGAACATTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031301.1-416s1c1
Sequence:CCGGCTTTGTGAATACCCTATCTGACTCGAGTCAGATAGGGTATTCACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks