EMAIL THIS PAGE TO A FRIEND

API5

apoptosis inhibitor 5

185 Gene Product Result for
Synonyms: AAC-11 AAC11
UniProtKB ID: Q9BZZ5, B4DGR0, B4DRJ2, D3DR21, O15441, Q9Y4J7
Gene ID:
Human(8539) Summary: This gene encodes an apoptosis inhibitory protein whose expression prevents apoptosis after growth factor deprivation. This protein suppresses the transcription factor E2F1-induced apoptosis and also interacts with, and negatively regulates Acinus, a nuclear factor involved in apoptotic DNA fragmentation. Its depletion enhances the cytotoxic action of the chemotherapeutic drugs. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
Mouse(11800) apoptosis inhibitor 5
Rat(362170) apoptosis inhibitor 5
naked mole-rat(101719611) apoptosis inhibitor 5
domestic guinea pig(100717249) apoptosis inhibitor 5
sheep(101108774) apoptosis inhibitor 5
Domestic Rabbit(100345733) apoptosis inhibitor 5
Zebrafish(321676) apoptosis inhibitor 5
dog(483413) apoptosis inhibitor 5
cow(538968) apoptosis inhibitor 5
Horse(100050009) apoptosis inhibitor 5
domestic cat(101081754) apoptosis inhibitor 5
chicken(423168) apoptosis inhibitor 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007466 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007466 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007466 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006595 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006595 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006595 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006595 Rosetta Predictions human pricing
NM_001127379 Rosetta Predictions rat pricing
NM_007466 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006595 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341901 predicted 458
2 SASI_Hs01_00191867 predicted 352
3 SASI_Hs02_00341902 predicted 897
4 SASI_Hs01_00191868 predicted 209
5 SASI_Hs01_00191869 predicted 215
6 SASI_Hs01_00191870 predicted 976
7 SASI_Hs01_00191871 predicted 340
8 SASI_Hs01_00191873 predicted 240
9 SASI_Hs02_00341903 predicted 1168
10 SASI_Hs02_00341904 predicted 482
11 SASI_Hs01_00191864 predicted 1069
12 SASI_Hs01_00191865 predicted 587
13 SASI_Hs01_00191866 predicted 661
14 SASI_Hs01_00191872 predicted 495
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127379 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253713 predicted 1434
2 SASI_Rn02_00253714 predicted 278
3 SASI_Rn02_00253715 predicted 390
4 SASI_Rn02_00253716 predicted 825
5 SASI_Rn02_00253717 predicted 1654
6 SASI_Rn02_00253718 predicted 1638
7 SASI_Rn02_00253719 predicted 830
8 SASI_Rn02_00253720 predicted 1074
9 SASI_Rn02_00253721 predicted 1532
10 SASI_Rn02_00253722 predicted 291
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007466 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184022 predicted 987
2 SASI_Mm01_00184023 predicted 924
3 SASI_Mm01_00184024 predicted 367
4 SASI_Mm01_00184026 predicted 668
5 SASI_Mm01_00184027 predicted 499
6 SASI_Mm01_00184028 predicted 1435
7 SASI_Mm01_00184029 predicted 1174
8 SASI_Mm01_00184031 predicted 909
9 SASI_Mm02_00311676 predicted 430
10 SASI_Mm02_00311677 predicted 379
11 SASI_Mm01_00184025 predicted 358
12 SASI_Mm01_00184030 predicted 1754
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007466
VALIDATED
API5 MISSION shRNA Bacterial Glycerol Stock
apoptosis inhibitor 5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120347    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007466.1-2847s1c1
Sequence:CCGGGCCCAGACTCTGTTCTTCATTCTCGAGAATGAAGAACAGAGTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007466.1-1157s1c1
Sequence:CCGGCCAGACTTCTTAACAGCCAAACTCGAGTTTGGCTGTTAAGAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007466.1-934s1c1
Sequence:CCGGGCTGGAGGTATTAAATTTGTTCTCGAGAACAAATTTAATACCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007466.1-1238s1c1
Sequence:CCGGCAGGTTTATATCAGACAACTTCTCGAGAAGTTGTCTGATATAAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007466.1-1552s1c1
Sequence:CCGGCAGCAATCTGAGCAACTTTAACTCGAGTTAAAGTTGCTCAGATTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007466.2-1227s21c1
Sequence:CCGGCCAGACTTCTTAACAGCCAAACTCGAGTTTGGCTGTTAAGAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007466.2-1308s21c1
Sequence:CCGGCAGGTTTATATCAGACAACTTCTCGAGAAGTTGTCTGATATAAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007466.2-1622s21c1
Sequence:CCGGCAGCAATCTGAGCAACTTTAACTCGAGTTAAAGTTGCTCAGATTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007466.2-2915s21c1
Sequence:CCGGGCCCAGACTCTGTTCTTCATTCTCGAGAATGAAGAACAGAGTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007466
VALIDATED
API5 MISSION shRNA shRNA Plasmid DNA
apoptosis inhibitor 5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120347    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007466.1-2847s1c1
Sequence:CCGGGCCCAGACTCTGTTCTTCATTCTCGAGAATGAAGAACAGAGTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007466.1-1157s1c1
Sequence:CCGGCCAGACTTCTTAACAGCCAAACTCGAGTTTGGCTGTTAAGAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007466.1-934s1c1
Sequence:CCGGGCTGGAGGTATTAAATTTGTTCTCGAGAACAAATTTAATACCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007466.1-1238s1c1
Sequence:CCGGCAGGTTTATATCAGACAACTTCTCGAGAAGTTGTCTGATATAAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007466.1-1552s1c1
Sequence:CCGGCAGCAATCTGAGCAACTTTAACTCGAGTTAAAGTTGCTCAGATTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007466.2-1227s21c1
Sequence:CCGGCCAGACTTCTTAACAGCCAAACTCGAGTTTGGCTGTTAAGAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007466.2-1308s21c1
Sequence:CCGGCAGGTTTATATCAGACAACTTCTCGAGAAGTTGTCTGATATAAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007466.2-1622s21c1
Sequence:CCGGCAGCAATCTGAGCAACTTTAACTCGAGTTAAAGTTGCTCAGATTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007466.2-2915s21c1
Sequence:CCGGGCCCAGACTCTGTTCTTCATTCTCGAGAATGAAGAACAGAGTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007466
VALIDATED
API5 MISSION shRNA Lentiviral Transduction Particles
apoptosis inhibitor 5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120347    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007466.1-2847s1c1
Sequence:CCGGGCCCAGACTCTGTTCTTCATTCTCGAGAATGAAGAACAGAGTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007466.1-1157s1c1
Sequence:CCGGCCAGACTTCTTAACAGCCAAACTCGAGTTTGGCTGTTAAGAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007466.1-934s1c1
Sequence:CCGGGCTGGAGGTATTAAATTTGTTCTCGAGAACAAATTTAATACCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007466.1-1238s1c1
Sequence:CCGGCAGGTTTATATCAGACAACTTCTCGAGAAGTTGTCTGATATAAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007466.1-1552s1c1
Sequence:CCGGCAGCAATCTGAGCAACTTTAACTCGAGTTAAAGTTGCTCAGATTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007466.2-1227s21c1
Sequence:CCGGCCAGACTTCTTAACAGCCAAACTCGAGTTTGGCTGTTAAGAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007466.2-1308s21c1
Sequence:CCGGCAGGTTTATATCAGACAACTTCTCGAGAAGTTGTCTGATATAAACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007466.2-1622s21c1
Sequence:CCGGCAGCAATCTGAGCAACTTTAACTCGAGTTAAAGTTGCTCAGATTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007466.2-2915s21c1
Sequence:CCGGGCCCAGACTCTGTTCTTCATTCTCGAGAATGAAGAACAGAGTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006595
VALIDATED
API5 MISSION shRNA Bacterial Glycerol Stock
apoptosis inhibitor 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006595.2-278s1c1
Sequence:CCGGGCAGCTCAATTTATTCCGAAACTCGAGTTTCGGAATAAATTGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006595.2-440s1c1
Sequence:CCGGGCAGATATACTAACGCAACTTCTCGAGAAGTTGCGTTAGTATATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006595.2-1611s1c1
Sequence:CCGGGCAGCAATTTGGGCAACTTTACTCGAGTAAAGTTGCCCAAATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006595.2-224s1c1
Sequence:CCGGGCCTATCAAGTGATATTGGATCTCGAGATCCAATATCACTTGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006595.2-909s1c1
Sequence:CCGGCCACAAGGTTTGTGACATATTCTCGAGAATATGTCACAAACCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006595.3-306s21c1
Sequence:CCGGGCAGCTCAATTTATTCCGAAACTCGAGTTTCGGAATAAATTGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006595.3-937s21c1
Sequence:CCGGCCACAAGGTTTGTGACATATTCTCGAGAATATGTCACAAACCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006595.3-1639s21c1
Sequence:CCGGGCAGCAATTTGGGCAACTTTACTCGAGTAAAGTTGCCCAAATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294026    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006595.3-2151s21c1
Sequence:CCGGGGAGAAGAGTAATGGTCAATCCTCGAGGATTGACCATTACTCTTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006595.3-520s21c1
Sequence:CCGGTAGTGAACAATGCCCTATTAACTCGAGTTAATAGGGCATTGTTCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006595
VALIDATED
API5 MISSION shRNA shRNA Plasmid DNA
apoptosis inhibitor 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006595.2-278s1c1
Sequence:CCGGGCAGCTCAATTTATTCCGAAACTCGAGTTTCGGAATAAATTGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006595.2-440s1c1
Sequence:CCGGGCAGATATACTAACGCAACTTCTCGAGAAGTTGCGTTAGTATATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006595.2-1611s1c1
Sequence:CCGGGCAGCAATTTGGGCAACTTTACTCGAGTAAAGTTGCCCAAATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006595.2-224s1c1
Sequence:CCGGGCCTATCAAGTGATATTGGATCTCGAGATCCAATATCACTTGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006595.2-909s1c1
Sequence:CCGGCCACAAGGTTTGTGACATATTCTCGAGAATATGTCACAAACCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006595.3-306s21c1
Sequence:CCGGGCAGCTCAATTTATTCCGAAACTCGAGTTTCGGAATAAATTGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006595.3-937s21c1
Sequence:CCGGCCACAAGGTTTGTGACATATTCTCGAGAATATGTCACAAACCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006595.3-1639s21c1
Sequence:CCGGGCAGCAATTTGGGCAACTTTACTCGAGTAAAGTTGCCCAAATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294026    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006595.3-2151s21c1
Sequence:CCGGGGAGAAGAGTAATGGTCAATCCTCGAGGATTGACCATTACTCTTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006595.3-520s21c1
Sequence:CCGGTAGTGAACAATGCCCTATTAACTCGAGTTAATAGGGCATTGTTCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006595
VALIDATED
API5 MISSION shRNA Lentiviral Transduction Particles
apoptosis inhibitor 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006595.2-278s1c1
Sequence:CCGGGCAGCTCAATTTATTCCGAAACTCGAGTTTCGGAATAAATTGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006595.2-440s1c1
Sequence:CCGGGCAGATATACTAACGCAACTTCTCGAGAAGTTGCGTTAGTATATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006595.2-1611s1c1
Sequence:CCGGGCAGCAATTTGGGCAACTTTACTCGAGTAAAGTTGCCCAAATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006595.2-224s1c1
Sequence:CCGGGCCTATCAAGTGATATTGGATCTCGAGATCCAATATCACTTGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006595.2-909s1c1
Sequence:CCGGCCACAAGGTTTGTGACATATTCTCGAGAATATGTCACAAACCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006595.3-306s21c1
Sequence:CCGGGCAGCTCAATTTATTCCGAAACTCGAGTTTCGGAATAAATTGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006595.3-937s21c1
Sequence:CCGGCCACAAGGTTTGTGACATATTCTCGAGAATATGTCACAAACCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006595.3-1639s21c1
Sequence:CCGGGCAGCAATTTGGGCAACTTTACTCGAGTAAAGTTGCCCAAATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294026    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006595.3-2151s21c1
Sequence:CCGGGGAGAAGAGTAATGGTCAATCCTCGAGGATTGACCATTACTCTTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006595.3-520s21c1
Sequence:CCGGTAGTGAACAATGCCCTATTAACTCGAGTTAATAGGGCATTGTTCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks