EMAIL THIS PAGE TO A FRIEND

APIP

APAF1 interacting protein

53 Gene Product Result for
Synonyms: APIP2 CGI29 MMRP19 dJ179L10.2 hAPIP
UniProtKB ID: Q96GX9, A8K9D3, Q6PJX6, Q8WVU2, Q96HK2, Q9Y318
Gene ID:
Human(51074) Summary: APIP is an APAF1 (MIM 602233)-interacting protein that acts as a negative regulator of ischemic/hypoxic injury (Cho et al., 2004 [PubMed 15262985]
Mouse(56369) APAF1 interacting protein
Rat(295961) APAF1 interacting protein
Zebrafish(447941) APAF1 interacting protein
domestic cat(101095130) APAF1 interacting protein
cow(508345) APAF1 interacting protein
dog(475943) APAF1 interacting protein
chicken(428860) APAF1 interacting protein
sheep(101105523) APAF1 interacting protein
domestic guinea pig(100732536) APAF1 interacting protein
naked mole-rat(101704355) APAF1 interacting protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019735 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019735 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019735 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015957 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015957 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015957 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015957 Rosetta Predictions human pricing
NM_001106492 Rosetta Predictions rat pricing
NM_019735 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015957 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202525 predicted 622
2 SASI_Hs01_00202519 predicted 835
3 SASI_Hs01_00202520 predicted 638
4 SASI_Hs01_00202521 predicted 870
5 SASI_Hs01_00202522 predicted 728
6 SASI_Hs01_00202523 predicted 840
7 SASI_Hs01_00202524 predicted 675
8 SASI_Hs02_00348606 predicted 637
9 SASI_Hs02_00348607 predicted 976
10 SASI_Hs02_00348608 predicted 676
11 SASI_Hs01_00202516 predicted 586
12 SASI_Hs01_00202517 predicted 577
13 SASI_Hs01_00202518 predicted 580
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106492 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219498 predicted 367
2 SASI_Rn02_00219499 predicted 510
3 SASI_Rn02_00219500 predicted 441
4 SASI_Rn02_00219501 predicted 373
5 SASI_Rn02_00219502 predicted 557
6 SASI_Rn02_00219503 predicted 657
7 SASI_Rn02_00219504 predicted 561
8 SASI_Rn02_00219505 predicted 548
9 SASI_Rn02_00219506 predicted 525
10 SASI_Rn02_00219507 predicted 565
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019735 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108952 predicted 512
2 SASI_Mm01_00108953 predicted 325
3 SASI_Mm01_00108954 predicted 438
4 SASI_Mm01_00108956 predicted 634
5 SASI_Mm01_00108957 predicted 253
6 SASI_Mm01_00108958 predicted 561
7 SASI_Mm01_00108959 predicted 561
8 SASI_Mm01_00108960 predicted 605
9 SASI_Mm01_00108961 predicted 578
10 SASI_Mm02_00324880 predicted 522
11 SASI_Mm01_00108955 predicted 496
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019735
VALIDATED
APIP MISSION shRNA Bacterial Glycerol Stock
APAF1 interacting protein
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019735.3-313s21c1
Sequence:CCGGTTCAGCCAGAAGACATGTTTGCTCGAGCAAACATGTCTTCTGGCTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019735.3-563s1c1
Sequence:CCGGCTATTACAGATACGATGATATCTCGAGATATCATCGTATCTGTAATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019735.3-549s21c1
Sequence:CCGGTGTACCTCAGGAGGCTATTACCTCGAGGTAATAGCCTCCTGAGGTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019735.3-517s21c1
Sequence:CCGGCACATCAAGAGATGATCAAAGCTCGAGCTTTGATCATCTCTTGATGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019735.3-447s21c1
Sequence:CCGGGTGATTCATACCCACTCTAAACTCGAGTTTAGAGTGGGTATGAATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019735.3-257s21c1
Sequence:CCGGCTTGAAGCATGGCAATGAAATCTCGAGATTTCATTGCCATGCTTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182960    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019735.2-523s1c1
Sequence:CCGGCAAGAGATGATCAAAGGAATACTCGAGTATTCCTTTGATCATCTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181062    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019735.2-628s1c1
Sequence:CCGGCTCAAAGAAAGGATGGCTCATCTCGAGATGAGCCATCCTTTCTTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019735
VALIDATED
APIP MISSION shRNA shRNA Plasmid DNA
APAF1 interacting protein
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019735.3-313s21c1
Sequence:CCGGTTCAGCCAGAAGACATGTTTGCTCGAGCAAACATGTCTTCTGGCTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019735.3-563s1c1
Sequence:CCGGCTATTACAGATACGATGATATCTCGAGATATCATCGTATCTGTAATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019735.3-549s21c1
Sequence:CCGGTGTACCTCAGGAGGCTATTACCTCGAGGTAATAGCCTCCTGAGGTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019735.3-517s21c1
Sequence:CCGGCACATCAAGAGATGATCAAAGCTCGAGCTTTGATCATCTCTTGATGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019735.3-447s21c1
Sequence:CCGGGTGATTCATACCCACTCTAAACTCGAGTTTAGAGTGGGTATGAATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019735.3-257s21c1
Sequence:CCGGCTTGAAGCATGGCAATGAAATCTCGAGATTTCATTGCCATGCTTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182960    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019735.2-523s1c1
Sequence:CCGGCAAGAGATGATCAAAGGAATACTCGAGTATTCCTTTGATCATCTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181062    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019735.2-628s1c1
Sequence:CCGGCTCAAAGAAAGGATGGCTCATCTCGAGATGAGCCATCCTTTCTTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019735
VALIDATED
APIP MISSION shRNA Lentiviral Transduction Particles
APAF1 interacting protein
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019735.3-313s21c1
Sequence:CCGGTTCAGCCAGAAGACATGTTTGCTCGAGCAAACATGTCTTCTGGCTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019735.3-563s1c1
Sequence:CCGGCTATTACAGATACGATGATATCTCGAGATATCATCGTATCTGTAATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019735.3-549s21c1
Sequence:CCGGTGTACCTCAGGAGGCTATTACCTCGAGGTAATAGCCTCCTGAGGTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019735.3-517s21c1
Sequence:CCGGCACATCAAGAGATGATCAAAGCTCGAGCTTTGATCATCTCTTGATGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019735.3-447s21c1
Sequence:CCGGGTGATTCATACCCACTCTAAACTCGAGTTTAGAGTGGGTATGAATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019735.3-257s21c1
Sequence:CCGGCTTGAAGCATGGCAATGAAATCTCGAGATTTCATTGCCATGCTTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182960    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019735.2-523s1c1
Sequence:CCGGCAAGAGATGATCAAAGGAATACTCGAGTATTCCTTTGATCATCTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181062    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019735.2-628s1c1
Sequence:CCGGCTCAAAGAAAGGATGGCTCATCTCGAGATGAGCCATCCTTTCTTTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015957
VALIDATED
APIP MISSION shRNA Bacterial Glycerol Stock
APAF1 interacting protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000220014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015957.2-548s1c1
Sequence:CCGGGTACTTCCGGAGGGTATTATACTCGAGTATAATACCCTCCGGAAGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000220015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015957.2-683s1c1
Sequence:CCGGTCAGACGTCATGGAGTATATGCTCGAGCATATACTCCATGACGTCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015957.1-147s1c1
Sequence:CCGGCCAAGATACCTGATCCCAGAACTCGAGTTCTGGGATCAGGTATCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015957.1-387s1c1
Sequence:CCGGGCTTACACAATGAGAGGAGCACTCGAGTGCTCCTCTCATTGTGTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015957.1-223s1c1
Sequence:CCGGGCTTGAAGCATGGCGATGAAACTCGAGTTTCATCGCCATGCTTCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158121    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015957.1-926s1c1
Sequence:CCGGCTGCAAATGGTCACCCTGAATCTCGAGATTCAGGGTGACCATTTGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015957.1-593s1c1
Sequence:CCGGCCTCAAAGATAGAATGGCTCACTCGAGTGAGCCATTCTATCTTTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151435    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015957.1-901s1c1
Sequence:CCGGGATGCTACTAATTTGCCACTACTCGAGTAGTGGCAAATTAGTAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015957.1-546s1c1
Sequence:CCGGGATATGTTAGTGGTACCCATTCTCGAGAATGGGTACCACTAACATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015957.1-738s1c1
Sequence:CCGGGCCGTATCAATGAAGAAAGTACTCGAGTACTTTCTTCATTGATACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015957
VALIDATED
APIP MISSION shRNA shRNA Plasmid DNA
APAF1 interacting protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000220014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015957.2-548s1c1
Sequence:CCGGGTACTTCCGGAGGGTATTATACTCGAGTATAATACCCTCCGGAAGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000220015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015957.2-683s1c1
Sequence:CCGGTCAGACGTCATGGAGTATATGCTCGAGCATATACTCCATGACGTCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015957.1-147s1c1
Sequence:CCGGCCAAGATACCTGATCCCAGAACTCGAGTTCTGGGATCAGGTATCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015957.1-387s1c1
Sequence:CCGGGCTTACACAATGAGAGGAGCACTCGAGTGCTCCTCTCATTGTGTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015957.1-223s1c1
Sequence:CCGGGCTTGAAGCATGGCGATGAAACTCGAGTTTCATCGCCATGCTTCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158121    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015957.1-926s1c1
Sequence:CCGGCTGCAAATGGTCACCCTGAATCTCGAGATTCAGGGTGACCATTTGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015957.1-593s1c1
Sequence:CCGGCCTCAAAGATAGAATGGCTCACTCGAGTGAGCCATTCTATCTTTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151435    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015957.1-901s1c1
Sequence:CCGGGATGCTACTAATTTGCCACTACTCGAGTAGTGGCAAATTAGTAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015957.1-546s1c1
Sequence:CCGGGATATGTTAGTGGTACCCATTCTCGAGAATGGGTACCACTAACATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015957.1-738s1c1
Sequence:CCGGGCCGTATCAATGAAGAAAGTACTCGAGTACTTTCTTCATTGATACGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015957
VALIDATED
APIP MISSION shRNA Lentiviral Transduction Particles
APAF1 interacting protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000220014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015957.2-548s1c1
Sequence:CCGGGTACTTCCGGAGGGTATTATACTCGAGTATAATACCCTCCGGAAGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000220015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015957.2-683s1c1
Sequence:CCGGTCAGACGTCATGGAGTATATGCTCGAGCATATACTCCATGACGTCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015957.1-147s1c1
Sequence:CCGGCCAAGATACCTGATCCCAGAACTCGAGTTCTGGGATCAGGTATCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015957.1-387s1c1
Sequence:CCGGGCTTACACAATGAGAGGAGCACTCGAGTGCTCCTCTCATTGTGTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015957.1-223s1c1
Sequence:CCGGGCTTGAAGCATGGCGATGAAACTCGAGTTTCATCGCCATGCTTCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158121    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015957.1-926s1c1
Sequence:CCGGCTGCAAATGGTCACCCTGAATCTCGAGATTCAGGGTGACCATTTGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015957.1-593s1c1
Sequence:CCGGCCTCAAAGATAGAATGGCTCACTCGAGTGAGCCATTCTATCTTTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151435    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015957.1-901s1c1
Sequence:CCGGGATGCTACTAATTTGCCACTACTCGAGTAGTGGCAAATTAGTAGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015957.1-546s1c1
Sequence:CCGGGATATGTTAGTGGTACCCATTCTCGAGAATGGGTACCACTAACATATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015957.1-738s1c1
Sequence:CCGGGCCGTATCAATGAAGAAAGTACTCGAGTACTTTCTTCATTGATACGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)