EMAIL THIS PAGE TO A FRIEND

APITD1

apoptosis-inducing, TAF9-like domain 1

63 Gene Product Result for
Synonyms: CENP-S CENPS FAAP16 MHF1
UniProtKB ID: Q8N2Z9, Q8NFE5, Q8NFG5
Gene ID:
Human(378708) Summary: This gene was identified in the neuroblastoma tumor suppressor candidate region on chromosome 1p36. It contains a TFIID-31 domain, similar to that found in TATA box-binding protein-associated factor, TAF(II)31, which is required for p53-mediated transcription activation. This gene was expressed at very low levels in neuroblastoma tumors, and was shown to reduce cell growth in neuroblastoma cells, suggesting that it may have a role in a cell death pathway. The protein is a component of multiple complexes, including the Fanconi anemia (FA) core complex, the APITD1/CENPS complex, and the CENPA-CAD (nucleosome distal) complex. Known functions include an involvement with chromatin associations of the FA core complex, and a role in the stable assembly of the outer kinetochore. Alternative splicing of this gene results in multiple transcript variants. Naturally occurring read-through transcripts also exist between this gene and the downstream cortistatin (CORT) gene, as represented in GeneID:100526739. An APITD1-related pseudogene has been identified on chromosome 7. [provided by RefSeq, Nov 2010]
Mouse(69928) apoptosis-inducing, TAF9-like domain 1
Rat(100534597) apoptosis-inducing, TAF9-like domain 1
sheep(101114968) apoptosis-inducing, TAF9-like domain 1
Domestic Rabbit(100534620) apoptosis-inducing, TAF9-like domain 1
Zebrafish(569270) apoptosis-inducing, TAF9-like domain 1
domestic cat(101096495) apoptosis-inducing, TAF9-like domain 1
cow(613732) apoptosis-inducing, TAF9-like domain 1
dog(487450) apoptosis-inducing, TAF9-like domain 1
chicken(771417) apoptosis-inducing, TAF9-like domain 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027263 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027263 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027263 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198544 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198544 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198544 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198544 Rosetta Predictions human pricing
NM_199294 Rosetta Predictions human pricing
NM_199295 Rosetta Predictions human pricing
NM_027263 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198544 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169915 predicted 1195
2 SASI_Hs01_00169916 predicted 572
3 SASI_Hs01_00169917 predicted 602
4 SASI_Hs01_00169919 predicted 913
5 SASI_Hs01_00169920 predicted 448
6 SASI_Hs01_00169921 predicted 923
7 SASI_Hs01_00169922 predicted 507
8 SASI_Hs01_00169923 predicted 931
9 SASI_Hs01_00169924 predicted 445
10 SASI_Hs02_00372148 predicted 535
11 SASI_Hs01_00169918 predicted 1048
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199294 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083930 predicted 671
2 SASI_Hs01_00083931 predicted 675
3 SASI_Hs01_00083932 predicted 675
4 SASI_Hs01_00083933 predicted 670
5 SASI_Hs01_00083934 predicted 967
6 SASI_Hs01_00083935 predicted 592
7 SASI_Hs01_00083936 predicted 1065
8 SASI_Hs01_00083937 predicted 574
9 SASI_Hs01_00083938 predicted 599
10 SASI_Hs02_00372721 predicted 442
11 SASI_Hs01_00083939 predicted 1079
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199295 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094159 predicted 858
2 SASI_Hs01_00094160 predicted 865
3 SASI_Hs01_00094161 predicted 866
4 SASI_Hs01_00094162 predicted 859
5 SASI_Hs01_00094163 predicted 1059
6 SASI_Hs01_00094164 predicted 1164
7 SASI_Hs01_00094165 predicted 1234
8 SASI_Hs01_00094166 predicted 1257
9 SASI_Hs01_00094167 predicted 761
10 SASI_Hs01_00094168 predicted 794
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027263 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196925 predicted 326
2 SASI_Mm01_00196926 predicted 326
3 SASI_Mm01_00196927 predicted 275
4 SASI_Mm01_00196928 predicted 282
5 SASI_Mm01_00196929 predicted 206
6 SASI_Mm01_00196930 predicted 262
7 SASI_Mm01_00196931 predicted 448
8 SASI_Mm01_00196932 predicted 210
9 SASI_Mm01_00196934 predicted 280
10 SASI_Mm02_00331842 predicted 445
11 SASI_Mm01_00196933 predicted 246
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027263
VALIDATED
APITD1 MISSION shRNA Bacterial Glycerol Stock
apoptosis-inducing, TAF9-like domain 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202254    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027263.1-632s1c1
Sequence:CCGGGCATAGGAAAGGCTTGCACTTCTCGAGAAGTGCAAGCCTTTCCTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027263.1-125s1c1
Sequence:CCGGCACGCTGAACAAACAGGTGAACTCGAGTTCACCTGTTTGTTCAGCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027263.1-284s1c1
Sequence:CCGGGCGAAATAATTCACTGCTAAACTCGAGTTTAGCAGTGAATTATTTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027263.1-272s1c1
Sequence:CCGGGCTCTTAGCCAGGCGAAATAACTCGAGTTATTTCGCCTGGCTAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027263.1-334s1c1
Sequence:CCGGCCCAGCTTAACCTGAAAGGAACTCGAGTTCCTTTCAGGTTAAGCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027263.1-207s1c1
Sequence:CCGGGCCAAAGACCTTGAAATGTTTCTCGAGAAACATTTCAAGGTCTTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200819    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027263.1-722s1c1
Sequence:CCGGGCTTAGTCCTTCACTGTTTATCTCGAGATAAACAGTGAAGGACTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027263
VALIDATED
APITD1 MISSION shRNA shRNA Plasmid DNA
apoptosis-inducing, TAF9-like domain 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202254    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027263.1-632s1c1
Sequence:CCGGGCATAGGAAAGGCTTGCACTTCTCGAGAAGTGCAAGCCTTTCCTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027263.1-125s1c1
Sequence:CCGGCACGCTGAACAAACAGGTGAACTCGAGTTCACCTGTTTGTTCAGCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027263.1-284s1c1
Sequence:CCGGGCGAAATAATTCACTGCTAAACTCGAGTTTAGCAGTGAATTATTTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027263.1-272s1c1
Sequence:CCGGGCTCTTAGCCAGGCGAAATAACTCGAGTTATTTCGCCTGGCTAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027263.1-334s1c1
Sequence:CCGGCCCAGCTTAACCTGAAAGGAACTCGAGTTCCTTTCAGGTTAAGCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027263.1-207s1c1
Sequence:CCGGGCCAAAGACCTTGAAATGTTTCTCGAGAAACATTTCAAGGTCTTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200819    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027263.1-722s1c1
Sequence:CCGGGCTTAGTCCTTCACTGTTTATCTCGAGATAAACAGTGAAGGACTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027263
VALIDATED
APITD1 MISSION shRNA Lentiviral Transduction Particles
apoptosis-inducing, TAF9-like domain 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202254    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027263.1-632s1c1
Sequence:CCGGGCATAGGAAAGGCTTGCACTTCTCGAGAAGTGCAAGCCTTTCCTATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027263.1-125s1c1
Sequence:CCGGCACGCTGAACAAACAGGTGAACTCGAGTTCACCTGTTTGTTCAGCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027263.1-284s1c1
Sequence:CCGGGCGAAATAATTCACTGCTAAACTCGAGTTTAGCAGTGAATTATTTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027263.1-272s1c1
Sequence:CCGGGCTCTTAGCCAGGCGAAATAACTCGAGTTATTTCGCCTGGCTAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027263.1-334s1c1
Sequence:CCGGCCCAGCTTAACCTGAAAGGAACTCGAGTTCCTTTCAGGTTAAGCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027263.1-207s1c1
Sequence:CCGGGCCAAAGACCTTGAAATGTTTCTCGAGAAACATTTCAAGGTCTTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200819    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027263.1-722s1c1
Sequence:CCGGGCTTAGTCCTTCACTGTTTATCTCGAGATAAACAGTGAAGGACTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198544
VALIDATED
APITD1 MISSION shRNA Bacterial Glycerol Stock
apoptosis-inducing, TAF9-like domain 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198544.2-548s21c1
Sequence:CCGGACAGACCATTGCGGCCATTTCCTCGAGGAAATGGCCGCAATGGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262597    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198544.2-1202s21c1
Sequence:CCGGAGCTAAAGGCTACACAATTAACTCGAGTTAATTGTGTAGCCTTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_198544.2-597s21c1
Sequence:CCGGTTTGCCAAAGACCTTGAAATGCTCGAGCATTTCAAGGTCTTTGGCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_198544.2-456s21c1
Sequence:CCGGTCTTACCAACAGAGGCTAAAGCTCGAGCTTTAGCCTCTGTTGGTAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_198544.2-668s21c1
Sequence:CCGGCTTAGCCAGGAGGAGTAATTCCTCGAGGAATTACTCCTCCTGGCTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198544
VALIDATED
APITD1 MISSION shRNA shRNA Plasmid DNA
apoptosis-inducing, TAF9-like domain 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198544.2-548s21c1
Sequence:CCGGACAGACCATTGCGGCCATTTCCTCGAGGAAATGGCCGCAATGGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262597    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198544.2-1202s21c1
Sequence:CCGGAGCTAAAGGCTACACAATTAACTCGAGTTAATTGTGTAGCCTTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_198544.2-597s21c1
Sequence:CCGGTTTGCCAAAGACCTTGAAATGCTCGAGCATTTCAAGGTCTTTGGCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_198544.2-456s21c1
Sequence:CCGGTCTTACCAACAGAGGCTAAAGCTCGAGCTTTAGCCTCTGTTGGTAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_198544.2-668s21c1
Sequence:CCGGCTTAGCCAGGAGGAGTAATTCCTCGAGGAATTACTCCTCCTGGCTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198544
VALIDATED
APITD1 MISSION shRNA Lentiviral Transduction Particles
apoptosis-inducing, TAF9-like domain 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198544.2-548s21c1
Sequence:CCGGACAGACCATTGCGGCCATTTCCTCGAGGAAATGGCCGCAATGGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262597    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198544.2-1202s21c1
Sequence:CCGGAGCTAAAGGCTACACAATTAACTCGAGTTAATTGTGTAGCCTTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_198544.2-597s21c1
Sequence:CCGGTTTGCCAAAGACCTTGAAATGCTCGAGCATTTCAAGGTCTTTGGCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_198544.2-456s21c1
Sequence:CCGGTCTTACCAACAGAGGCTAAAGCTCGAGCTTTAGCCTCTGTTGGTAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_198544.2-668s21c1
Sequence:CCGGCTTAGCCAGGAGGAGTAATTCCTCGAGGAATTACTCCTCCTGGCTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)