EMAIL THIS PAGE TO A FRIEND

APLF

aprataxin and PNKP like factor

96 Gene Product Result for
Synonyms: APFL C2orf13 PALF Xip1
UniProtKB ID: Q8IW19, A8K476, Q53P47, Q53PB9, Q53QU0
Gene ID:
Human(200558) Summary: C2ORF13 is a component of the cellular response to chromosomal DNA single- and double-strand breaks (Iles et al., 2007 [PubMed 17353262]
Mouse(72103) aprataxin and PNKP like factor
Rat(500247) aprataxin and PNKP like factor
chicken(421264) aprataxin and PNKP like factor
dog(481405) aprataxin and PNKP like factor
domestic cat(101092931) aprataxin and PNKP like factor
cow(507989) aprataxin and PNKP like factor
Horse(100061683) aprataxin and PNKP like factor
naked mole-rat(101704813) aprataxin and PNKP like factor
domestic guinea pig(100729628) aprataxin and PNKP like factor
sheep(101116898) aprataxin and PNKP like factor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024251 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024251 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024251 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173545 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173545 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173545 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173545 Rosetta Predictions human pricing
XM_001075022 Rosetta Predictions rat pricing
XM_575597 Rosetta Predictions rat pricing
NM_024251 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173545 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140068 predicted 1018
2 SASI_Hs02_00368348 predicted 742
3 SASI_Hs01_00140069 predicted 1187
4 SASI_Hs02_00368349 predicted 986
5 SASI_Hs01_00140072 predicted 1318
6 SASI_Hs02_00368350 predicted 898
7 SASI_Hs01_00140073 predicted 683
8 SASI_Hs02_00368351 predicted 1713
9 SASI_Hs02_00368352 predicted 967
10 SASI_Hs02_00368353 predicted 1670
11 SASI_Hs01_00140067 predicted 231
12 SASI_Hs01_00140070 predicted 339
13 SASI_Hs01_00140071 predicted 999
14 SASI_Hs01_00140074 predicted 738
15 SASI_Hs01_00140075 predicted 517
16 SASI_Hs01_00140076 predicted 1188
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075022 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00348150 predicted 1366
2 SASI_Rn02_00348151 predicted 1028
3 SASI_Rn02_00348152 predicted 1059
4 SASI_Rn02_00348153 predicted 1037
5 SASI_Rn02_00348154 predicted 1301
6 SASI_Rn02_00348155 predicted 313
7 SASI_Rn02_00348156 predicted 366
8 SASI_Rn02_00348157 predicted 989
9 SASI_Rn02_00348158 predicted 698
10 SASI_Rn02_00348159 predicted 470
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575597 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403873 predicted 1366
2 SASI_Rn02_00403874 predicted 1020
3 SASI_Rn02_00403875 predicted 1060
4 SASI_Rn02_00403876 predicted 1037
5 SASI_Rn02_00403877 predicted 1298
6 SASI_Rn02_00403878 predicted 316
7 SASI_Rn02_00403879 predicted 361
8 SASI_Rn02_00403880 predicted 986
9 SASI_Rn02_00403881 predicted 692
10 SASI_Rn02_00403882 predicted 474
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024251 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032294 predicted 388
2 SASI_Mm01_00032295 predicted 621
3 SASI_Mm01_00032297 predicted 850
4 SASI_Mm01_00032299 predicted 394
5 SASI_Mm01_00032300 predicted 956
6 SASI_Mm01_00032301 predicted 509
7 SASI_Mm01_00032302 predicted 1243
8 SASI_Mm02_00327638 predicted 622
9 SASI_Mm02_00327639 predicted 338
10 SASI_Mm02_00327640 predicted 1017
11 SASI_Mm01_00032293 predicted 918
12 SASI_Mm01_00032296 predicted 225
13 SASI_Mm01_00032298 predicted 405
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024251
VALIDATED
APLF MISSION shRNA Bacterial Glycerol Stock
aprataxin and PNKP like factor
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024251.3-917s21c1
Sequence:CCGGGGATATTGTGAAGACAAATAACTCGAGTTATTTGTCTTCACAATATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024251.3-2017s21c1
Sequence:CCGGGAATCCTGGGAAGACTATTAACTCGAGTTAATAGTCTTCCCAGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024251.3-417s1c1
Sequence:CCGGCTTGATGAAGATGATATATTGCTCGAGCAATATATCATCTTCATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216580    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024251.3-917s1c1
Sequence:CCGGGGATATTGTGAAGACAAATAACTCGAGTTATTTGTCTTCACAATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024251.3-459s21c1
Sequence:CCGGGTGGTTAACTTACCTGATAAGCTCGAGCTTATCAGGTAAGTTAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024251.3-499s21c1
Sequence:CCGGTGCAAGGAAGCCCTGAAATAACTCGAGTTATTTCAGGGCTTCCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024251.3-191s21c1
Sequence:CCGGCATTCTTGAAGTGGTTGATAGCTCGAGCTATCAACCACTTCAAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024251.2-1343s1c1
Sequence:CCGGCCCAGCACAAGATGGAATATACTCGAGTATATTCCATCTTGTGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200905    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024251.2-1724s1c1
Sequence:CCGGCCATCAGTGAAAGCAGGTAAACTCGAGTTTACCTGCTTTCACTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024251
VALIDATED
APLF MISSION shRNA shRNA Plasmid DNA
aprataxin and PNKP like factor
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024251.3-917s21c1
Sequence:CCGGGGATATTGTGAAGACAAATAACTCGAGTTATTTGTCTTCACAATATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024251.3-2017s21c1
Sequence:CCGGGAATCCTGGGAAGACTATTAACTCGAGTTAATAGTCTTCCCAGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024251.3-417s1c1
Sequence:CCGGCTTGATGAAGATGATATATTGCTCGAGCAATATATCATCTTCATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216580    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024251.3-917s1c1
Sequence:CCGGGGATATTGTGAAGACAAATAACTCGAGTTATTTGTCTTCACAATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024251.3-459s21c1
Sequence:CCGGGTGGTTAACTTACCTGATAAGCTCGAGCTTATCAGGTAAGTTAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024251.3-499s21c1
Sequence:CCGGTGCAAGGAAGCCCTGAAATAACTCGAGTTATTTCAGGGCTTCCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024251.3-191s21c1
Sequence:CCGGCATTCTTGAAGTGGTTGATAGCTCGAGCTATCAACCACTTCAAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024251.2-1343s1c1
Sequence:CCGGCCCAGCACAAGATGGAATATACTCGAGTATATTCCATCTTGTGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200905    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024251.2-1724s1c1
Sequence:CCGGCCATCAGTGAAAGCAGGTAAACTCGAGTTTACCTGCTTTCACTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024251
VALIDATED
APLF MISSION shRNA Lentiviral Transduction Particles
aprataxin and PNKP like factor
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024251.3-917s21c1
Sequence:CCGGGGATATTGTGAAGACAAATAACTCGAGTTATTTGTCTTCACAATATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024251.3-2017s21c1
Sequence:CCGGGAATCCTGGGAAGACTATTAACTCGAGTTAATAGTCTTCCCAGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024251.3-417s1c1
Sequence:CCGGCTTGATGAAGATGATATATTGCTCGAGCAATATATCATCTTCATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216580    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024251.3-917s1c1
Sequence:CCGGGGATATTGTGAAGACAAATAACTCGAGTTATTTGTCTTCACAATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024251.3-459s21c1
Sequence:CCGGGTGGTTAACTTACCTGATAAGCTCGAGCTTATCAGGTAAGTTAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024251.3-499s21c1
Sequence:CCGGTGCAAGGAAGCCCTGAAATAACTCGAGTTATTTCAGGGCTTCCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024251.3-191s21c1
Sequence:CCGGCATTCTTGAAGTGGTTGATAGCTCGAGCTATCAACCACTTCAAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024251.2-1343s1c1
Sequence:CCGGCCCAGCACAAGATGGAATATACTCGAGTATATTCCATCTTGTGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200905    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024251.2-1724s1c1
Sequence:CCGGCCATCAGTGAAAGCAGGTAAACTCGAGTTTACCTGCTTTCACTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173545
APLF MISSION shRNA Bacterial Glycerol Stock
aprataxin and PNKP like factor
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167835    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173545.1-3035s1c1
Sequence:CCGGGCCACTAACTTAATCCTTGAACTCGAGTTCAAGGATTAAGTTAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167011    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173545.1-2599s1c1
Sequence:CCGGGCCCTATAATGCTCTTCATATCTCGAGATATGAAGAGCATTATAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173545.1-1314s1c1
Sequence:CCGGCATCCTGGTGATAGTGATTATCTCGAGATAATCACTATCACCAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173545.1-516s1c1
Sequence:CCGGCCCGTGATTAATTTACCTCATCTCGAGATGAGGTAAATTAATCACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173545.1-782s1c1
Sequence:CCGGCAAAGATAAATCCCAGCTAAACTCGAGTTTAGCTGGGATTTATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173545
APLF MISSION shRNA shRNA Plasmid DNA
aprataxin and PNKP like factor
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167835    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173545.1-3035s1c1
Sequence:CCGGGCCACTAACTTAATCCTTGAACTCGAGTTCAAGGATTAAGTTAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167011    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173545.1-2599s1c1
Sequence:CCGGGCCCTATAATGCTCTTCATATCTCGAGATATGAAGAGCATTATAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173545.1-1314s1c1
Sequence:CCGGCATCCTGGTGATAGTGATTATCTCGAGATAATCACTATCACCAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173545.1-516s1c1
Sequence:CCGGCCCGTGATTAATTTACCTCATCTCGAGATGAGGTAAATTAATCACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173545.1-782s1c1
Sequence:CCGGCAAAGATAAATCCCAGCTAAACTCGAGTTTAGCTGGGATTTATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173545
APLF MISSION shRNA Lentiviral Transduction Particles
aprataxin and PNKP like factor
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167835    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173545.1-3035s1c1
Sequence:CCGGGCCACTAACTTAATCCTTGAACTCGAGTTCAAGGATTAAGTTAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167011    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173545.1-2599s1c1
Sequence:CCGGGCCCTATAATGCTCTTCATATCTCGAGATATGAAGAGCATTATAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173545.1-1314s1c1
Sequence:CCGGCATCCTGGTGATAGTGATTATCTCGAGATAATCACTATCACCAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173545.1-516s1c1
Sequence:CCGGCCCGTGATTAATTTACCTCATCTCGAGATGAGGTAAATTAATCACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173545.1-782s1c1
Sequence:CCGGCAAAGATAAATCCCAGCTAAACTCGAGTTTAGCTGGGATTTATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks