EMAIL THIS PAGE TO A FRIEND

APLN

apelin

66 Gene Product Result for
Synonyms: APEL XNPEP2
UniProtKB ID: Q9ULZ1, Q4VY08, Q8WU89
Gene ID:
Human(8862) Summary: This gene encodes a peptide that functions as an endogenous ligand for the G protein coupled receptor APJ. The encoded protein is synthesized as a prepropeptide that is processed into biologically active C-terminal fragments. The peptide fragments activate different tissue specific signaling pathways that regulate diverse biological functions including fluid homeostasis, cardiovascular function and insulin secretion. This protein also functions as a coreceptor for the human immunodeficiency virus 1.[provided by RefSeq, Feb 2010]
Mouse(30878) apelin
Rat(58812) apelin
cow(282143) apelin
dog(611497) apelin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Proteins

Product # Description Species Add to Cart
 
A6469 Apelin-13 trifluoroacetate salt ≥95% human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013912 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013912 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013912 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017413 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017413 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017413 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017413 Rosetta Predictions human pricing
NM_031612 Rosetta Predictions rat pricing
NM_013912 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017413 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191166 predicted 572
2 SASI_Hs01_00191167 predicted 575
3 SASI_Hs01_00191168 predicted 722
4 SASI_Hs02_00349975 predicted 585
5 SASI_Hs01_00191169 predicted 1004
6 SASI_Hs01_00191170 predicted 709
7 SASI_Hs01_00191171 predicted 1011
8 SASI_Hs01_00191172 predicted 375
9 SASI_Hs01_00191173 predicted 630
10 SASI_Hs01_00191174 predicted 1019
11 SASI_Hs01_00191175 predicted 780
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031612 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078293 predicted 645
2 SASI_Rn02_00264903 predicted 872
3 SASI_Rn01_00078295 predicted 983
4 SASI_Rn01_00078296 predicted 686
5 SASI_Rn01_00078297 predicted 935
6 SASI_Rn02_00264904 predicted 767
7 SASI_Rn01_00078300 predicted 550
8 SASI_Rn01_00078301 predicted 544
9 SASI_Rn01_00078302 predicted 1004
10 SASI_Rn02_00264905 predicted 633
11 SASI_Rn01_00078294 predicted 401
12 SASI_Rn01_00078298 predicted 433
13 SASI_Rn01_00078299 predicted 945
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013912 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126025 predicted 576
2 SASI_Mm01_00126026 predicted 618
3 SASI_Mm01_00126027 predicted 661
4 SASI_Mm01_00126028 predicted 868
5 SASI_Mm01_00126029 predicted 645
6 SASI_Mm01_00126030 predicted 653
7 SASI_Mm01_00126032 predicted 967
8 SASI_Mm01_00126033 predicted 646
9 SASI_Mm01_00126034 predicted 400
10 SASI_Mm02_00323008 predicted 565
11 SASI_Mm01_00126031 predicted 1062
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013912
VALIDATED
APLN MISSION shRNA Bacterial Glycerol Stock
apelin
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042758    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013912.2-2590s1c1
Sequence:CCGGCCTTACTCTTTGAGGTCATATCTCGAGATATGACCTCAAAGAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013912.2-413s1c1
Sequence:CCGGCCAGATGGAACAGGACTAGAACTCGAGTTCTAGTCCTGTTCCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013912.2-398s1c1
Sequence:CCGGCCACTGATGTTGCCTCCAGATCTCGAGATCTGGAGGCAACATCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013912.2-430s1c1
Sequence:CCGGAGAAGAAGGAAGCATGCGCTACTCGAGTAGCGCATGCTTCCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013912.2-502s1c1
Sequence:CCGGCAGGAGGAAATTTCGCAGACACTCGAGTGTCTGCGAAATTTCCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013912.3-573s21c1
Sequence:CCGGCCTTTCTAAAGCAGGATTGAACTCGAGTTCAATCCTGCTTTAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013912.3-513s21c1
Sequence:CCGGCAGGGAGGCAGGAGGAAATTTCTCGAGAAATTTCCTCCTGCCTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013912.3-407s21c1
Sequence:CCGGTTGTGGAGTGCCACTGATGTTCTCGAGAACATCAGTGGCACTCCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013912.3-862s21c1
Sequence:CCGGATGCGGTAGTCCCTATCTTTCCTCGAGGAAAGATAGGGACTACCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013912.3-433s21c1
Sequence:CCGGCAGATGGAACAGGACTAGAAGCTCGAGCTTCTAGTCCTGTTCCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013912
VALIDATED
APLN MISSION shRNA shRNA Plasmid DNA
apelin
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042758    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013912.2-2590s1c1
Sequence:CCGGCCTTACTCTTTGAGGTCATATCTCGAGATATGACCTCAAAGAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013912.2-413s1c1
Sequence:CCGGCCAGATGGAACAGGACTAGAACTCGAGTTCTAGTCCTGTTCCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013912.2-398s1c1
Sequence:CCGGCCACTGATGTTGCCTCCAGATCTCGAGATCTGGAGGCAACATCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013912.2-430s1c1
Sequence:CCGGAGAAGAAGGAAGCATGCGCTACTCGAGTAGCGCATGCTTCCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013912.2-502s1c1
Sequence:CCGGCAGGAGGAAATTTCGCAGACACTCGAGTGTCTGCGAAATTTCCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013912.3-573s21c1
Sequence:CCGGCCTTTCTAAAGCAGGATTGAACTCGAGTTCAATCCTGCTTTAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013912.3-513s21c1
Sequence:CCGGCAGGGAGGCAGGAGGAAATTTCTCGAGAAATTTCCTCCTGCCTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013912.3-407s21c1
Sequence:CCGGTTGTGGAGTGCCACTGATGTTCTCGAGAACATCAGTGGCACTCCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013912.3-862s21c1
Sequence:CCGGATGCGGTAGTCCCTATCTTTCCTCGAGGAAAGATAGGGACTACCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013912.3-433s21c1
Sequence:CCGGCAGATGGAACAGGACTAGAAGCTCGAGCTTCTAGTCCTGTTCCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013912
VALIDATED
APLN MISSION shRNA Lentiviral Transduction Particles
apelin
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042758    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013912.2-2590s1c1
Sequence:CCGGCCTTACTCTTTGAGGTCATATCTCGAGATATGACCTCAAAGAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013912.2-413s1c1
Sequence:CCGGCCAGATGGAACAGGACTAGAACTCGAGTTCTAGTCCTGTTCCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013912.2-398s1c1
Sequence:CCGGCCACTGATGTTGCCTCCAGATCTCGAGATCTGGAGGCAACATCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013912.2-430s1c1
Sequence:CCGGAGAAGAAGGAAGCATGCGCTACTCGAGTAGCGCATGCTTCCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013912.2-502s1c1
Sequence:CCGGCAGGAGGAAATTTCGCAGACACTCGAGTGTCTGCGAAATTTCCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013912.3-573s21c1
Sequence:CCGGCCTTTCTAAAGCAGGATTGAACTCGAGTTCAATCCTGCTTTAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013912.3-513s21c1
Sequence:CCGGCAGGGAGGCAGGAGGAAATTTCTCGAGAAATTTCCTCCTGCCTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013912.3-407s21c1
Sequence:CCGGTTGTGGAGTGCCACTGATGTTCTCGAGAACATCAGTGGCACTCCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013912.3-862s21c1
Sequence:CCGGATGCGGTAGTCCCTATCTTTCCTCGAGGAAAGATAGGGACTACCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013912.3-433s21c1
Sequence:CCGGCAGATGGAACAGGACTAGAAGCTCGAGCTTCTAGTCCTGTTCCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017413
APLN MISSION shRNA Bacterial Glycerol Stock
apelin
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156143    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017413.3-711s1c1
Sequence:CCGGCCTGGCTGTAGTTTGGATGATCTCGAGATCATCCAAACTACAGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017413.3-991s1c1
Sequence:CCGGCCAGGGAAGAATGCAGAGAAACTCGAGTTTCTCTGCATTCTTCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151869    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017413.3-2545s1c1
Sequence:CCGGCAAAGATATTAAGGCCCTGTTCTCGAGAACAGGGCCTTAATATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151069    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017413.3-1338s1c1
Sequence:CCGGGCCAAGAATCACAGAATGTTACTCGAGTAACATTCTGTGATTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017413.3-2587s1c1
Sequence:CCGGCCCTGTGTTCAATGTTTGTAACTCGAGTTACAAACATTGAACACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154371    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017413.3-590s1c1
Sequence:CCGGCCTCCATAGATTGGTCTGCTTCTCGAGAAGCAGACCAATCTATGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155345    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017413.3-2884s1c1
Sequence:CCGGGCATCTGTTTGGGTGTCCTAACTCGAGTTAGGACACCCAAACAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017413.3-472s21c1
Sequence:CCGGGCAGGGAGGTCGGAGGAAATTCTCGAGAATTTCCTCCGACCTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017413.3-518s21c1
Sequence:CCGGCATAAGGGACCCATGCCTTTCCTCGAGGAAAGGCATGGGTCCCTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358701    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017413.3-732s21c1
Sequence:CCGGTCCCGTTCTCTCACAAGAATCCTCGAGGATTCTTGTGAGAGAACGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358700    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017413.3-1013s21c1
Sequence:CCGGGCAAGGAGAGACTCTAGTTAACTCGAGTTAACTAGAGTCTCTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017413
APLN MISSION shRNA shRNA Plasmid DNA
apelin
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156143    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017413.3-711s1c1
Sequence:CCGGCCTGGCTGTAGTTTGGATGATCTCGAGATCATCCAAACTACAGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017413.3-991s1c1
Sequence:CCGGCCAGGGAAGAATGCAGAGAAACTCGAGTTTCTCTGCATTCTTCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151869    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017413.3-2545s1c1
Sequence:CCGGCAAAGATATTAAGGCCCTGTTCTCGAGAACAGGGCCTTAATATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151069    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017413.3-1338s1c1
Sequence:CCGGGCCAAGAATCACAGAATGTTACTCGAGTAACATTCTGTGATTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017413.3-2587s1c1
Sequence:CCGGCCCTGTGTTCAATGTTTGTAACTCGAGTTACAAACATTGAACACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154371    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017413.3-590s1c1
Sequence:CCGGCCTCCATAGATTGGTCTGCTTCTCGAGAAGCAGACCAATCTATGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155345    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017413.3-2884s1c1
Sequence:CCGGGCATCTGTTTGGGTGTCCTAACTCGAGTTAGGACACCCAAACAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017413.3-472s21c1
Sequence:CCGGGCAGGGAGGTCGGAGGAAATTCTCGAGAATTTCCTCCGACCTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017413.3-518s21c1
Sequence:CCGGCATAAGGGACCCATGCCTTTCCTCGAGGAAAGGCATGGGTCCCTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358701    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017413.3-732s21c1
Sequence:CCGGTCCCGTTCTCTCACAAGAATCCTCGAGGATTCTTGTGAGAGAACGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358700    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017413.3-1013s21c1
Sequence:CCGGGCAAGGAGAGACTCTAGTTAACTCGAGTTAACTAGAGTCTCTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017413
APLN MISSION shRNA Lentiviral Transduction Particles
apelin
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156143    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017413.3-711s1c1
Sequence:CCGGCCTGGCTGTAGTTTGGATGATCTCGAGATCATCCAAACTACAGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017413.3-991s1c1
Sequence:CCGGCCAGGGAAGAATGCAGAGAAACTCGAGTTTCTCTGCATTCTTCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151869    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017413.3-2545s1c1
Sequence:CCGGCAAAGATATTAAGGCCCTGTTCTCGAGAACAGGGCCTTAATATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151069    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017413.3-1338s1c1
Sequence:CCGGGCCAAGAATCACAGAATGTTACTCGAGTAACATTCTGTGATTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017413.3-2587s1c1
Sequence:CCGGCCCTGTGTTCAATGTTTGTAACTCGAGTTACAAACATTGAACACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154371    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017413.3-590s1c1
Sequence:CCGGCCTCCATAGATTGGTCTGCTTCTCGAGAAGCAGACCAATCTATGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155345    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017413.3-2884s1c1
Sequence:CCGGGCATCTGTTTGGGTGTCCTAACTCGAGTTAGGACACCCAAACAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017413.3-472s21c1
Sequence:CCGGGCAGGGAGGTCGGAGGAAATTCTCGAGAATTTCCTCCGACCTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017413.3-518s21c1
Sequence:CCGGCATAAGGGACCCATGCCTTTCCTCGAGGAAAGGCATGGGTCCCTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358701    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017413.3-732s21c1
Sequence:CCGGTCCCGTTCTCTCACAAGAATCCTCGAGGATTCTTGTGAGAGAACGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358700    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017413.3-1013s21c1
Sequence:CCGGGCAAGGAGAGACTCTAGTTAACTCGAGTTAACTAGAGTCTCTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks