EMAIL THIS PAGE TO A FRIEND

APLNR

apelin receptor

121 Gene Product Result for
Synonyms: AGTRL1 APJ APJR HG11
UniProtKB ID: P35414
Gene ID:
Human(187) Summary: This gene encodes a member of the G protein-coupled receptor gene family. The encoded protein is related to the angiotensin receptor, but is actually an apelin receptor that inhibits adenylate cyclase activity and plays a counter-regulatory role against the pressure action of angiotensin II by exerting hypertensive effect. It functions in the cardiovascular and central nervous systems, in glucose metabolism, in embryonic and tumor angiogenesis and as a human immunodeficiency virus (HIV-1) coreceptor. Two transcript variants resulting from alternative splicing have been identified. [provided by RefSeq, Jul 2009]
Mouse(23796) apelin receptor
Rat(83518) apelin receptor
naked mole-rat(101698984) apelin receptor
sheep(101119419) apelin receptor
Domestic Rabbit(100348126) apelin receptor
chicken(429337) apelin receptor
domestic cat(101088782) apelin receptor
cow(615435) apelin receptor
dog(483497) apelin receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011784 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011784 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011784 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005161 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005161 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005161 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005161 Rosetta Predictions human pricing
NM_031349 Rosetta Predictions rat pricing
NM_011784 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005161 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186275 predicted 1511
2 SASI_Hs01_00186276 predicted 472
3 SASI_Hs01_00186277 predicted 483
4 SASI_Hs01_00186278 predicted 528
5 SASI_Hs01_00186279 predicted 515
6 SASI_Hs01_00186280 predicted 1087
7 SASI_Hs01_00186281 predicted 750
8 SASI_Hs01_00186282 predicted 1136
9 SASI_Hs01_00186284 predicted 515
10 SASI_Hs02_00339105 predicted 484
11 SASI_Hs01_00186283 predicted 1289
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031349 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264586 predicted 468
2 SASI_Rn02_00264587 predicted 1229
3 SASI_Rn02_00264588 predicted 1067
4 SASI_Rn02_00264589 predicted 767
5 SASI_Rn02_00264590 predicted 1445
6 SASI_Rn02_00264591 predicted 836
7 SASI_Rn02_00264592 predicted 263
8 SASI_Rn02_00264593 predicted 1247
9 SASI_Rn02_00264594 predicted 1396
10 SASI_Rn02_00264595 predicted 327
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011784 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059160 predicted 453
2 SASI_Mm01_00059161 predicted 490
3 SASI_Mm01_00059162 predicted 1336
4 SASI_Mm01_00059163 predicted 977
5 SASI_Mm01_00059164 predicted 787
6 SASI_Mm01_00059165 predicted 937
7 SASI_Mm01_00059166 predicted 1210
8 SASI_Mm01_00059167 predicted 1266
9 SASI_Mm01_00059168 predicted 1416
10 SASI_Mm01_00059169 predicted 759
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011784
APLNR MISSION shRNA Bacterial Glycerol Stock
apelin receptor
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011784.3-1287s21c1
Sequence:CCGGTGAGAAGTCAGCCAGTTATTCCTCGAGGAATAACTGGCTGACTTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426595    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011784.3-1675s21c1
Sequence:CCGGATAAATGAGGGAAGGTTATATCTCGAGATATAACCTTCCCTCATTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011784.2-330s1c1
Sequence:CCGGCCTGCCATCTACATGTTGGTTCTCGAGAACCAACATGTAGATGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011784.2-1342s1c1
Sequence:CCGGCGATTCCCTATAGTCAAGAAACTCGAGTTTCTTGACTATAGGGAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011784.2-1031s1c1
Sequence:CCGGCCTGGTGAAGACTCTCTACATCTCGAGATGTAGAGAGTCTTCACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011784.2-1255s1c1
Sequence:CCGGCCGAGAAGTCAGCCAGTTATTCTCGAGAATAACTGGCTGACTTCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011784.2-1691s1c1
Sequence:CCGGCCTGATCTAATTTGCTTCATTCTCGAGAATGAAGCAAATTAGATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011784
APLNR MISSION shRNA shRNA Plasmid DNA
apelin receptor
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011784.3-1287s21c1
Sequence:CCGGTGAGAAGTCAGCCAGTTATTCCTCGAGGAATAACTGGCTGACTTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426595    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011784.3-1675s21c1
Sequence:CCGGATAAATGAGGGAAGGTTATATCTCGAGATATAACCTTCCCTCATTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011784.2-330s1c1
Sequence:CCGGCCTGCCATCTACATGTTGGTTCTCGAGAACCAACATGTAGATGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011784.2-1342s1c1
Sequence:CCGGCGATTCCCTATAGTCAAGAAACTCGAGTTTCTTGACTATAGGGAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011784.2-1031s1c1
Sequence:CCGGCCTGGTGAAGACTCTCTACATCTCGAGATGTAGAGAGTCTTCACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011784.2-1255s1c1
Sequence:CCGGCCGAGAAGTCAGCCAGTTATTCTCGAGAATAACTGGCTGACTTCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011784.2-1691s1c1
Sequence:CCGGCCTGATCTAATTTGCTTCATTCTCGAGAATGAAGCAAATTAGATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011784
APLNR MISSION shRNA Lentiviral Transduction Particles
apelin receptor
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011784.3-1287s21c1
Sequence:CCGGTGAGAAGTCAGCCAGTTATTCCTCGAGGAATAACTGGCTGACTTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426595    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011784.3-1675s21c1
Sequence:CCGGATAAATGAGGGAAGGTTATATCTCGAGATATAACCTTCCCTCATTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011784.2-330s1c1
Sequence:CCGGCCTGCCATCTACATGTTGGTTCTCGAGAACCAACATGTAGATGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011784.2-1342s1c1
Sequence:CCGGCGATTCCCTATAGTCAAGAAACTCGAGTTTCTTGACTATAGGGAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011784.2-1031s1c1
Sequence:CCGGCCTGGTGAAGACTCTCTACATCTCGAGATGTAGAGAGTCTTCACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011784.2-1255s1c1
Sequence:CCGGCCGAGAAGTCAGCCAGTTATTCTCGAGAATAACTGGCTGACTTCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011784.2-1691s1c1
Sequence:CCGGCCTGATCTAATTTGCTTCATTCTCGAGAATGAAGCAAATTAGATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005161
APLNR MISSION shRNA Bacterial Glycerol Stock
apelin receptor
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356634    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005161.4-1934s21c1
Sequence:CCGGTTAGATCTGCAATCGTCTTTCCTCGAGGAAAGACGATTGCAGATCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356636    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005161.4-1889s21c1
Sequence:CCGGCCTGAGTCTGGACGCAGTAAACTCGAGTTTACTGCGTCCAGACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005161.4-1534s21c1
Sequence:CCGGGAGAACAGATGCACGAGAAATCTCGAGATTTCTCGTGCATCTGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005161.2-961s1c1
Sequence:CCGGGCTGACCTGTTACTTCTTCATCTCGAGATGAAGAAGTAACAGGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005161.2-628s1c1
Sequence:CCGGCTACCTCATCTTCGTCAACATCTCGAGATGTTGACGAAGATGAGGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008097    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005161.2-1579s1c1
Sequence:CCGGGCTTCTAGAAGGGAAGAAATTCTCGAGAATTTCTTCCCTTCTAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005161.2-1393s1c1
Sequence:CCGGTGGAGAACAGATGCACGAGAACTCGAGTTCTCGTGCATCTGTTCTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005161.2-494s1c1
Sequence:CCGGCGCTCAGCTGATATCTTCATTCTCGAGAATGAAGATATCAGCTGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005161
APLNR MISSION shRNA shRNA Plasmid DNA
apelin receptor
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356634    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005161.4-1934s21c1
Sequence:CCGGTTAGATCTGCAATCGTCTTTCCTCGAGGAAAGACGATTGCAGATCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356636    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005161.4-1889s21c1
Sequence:CCGGCCTGAGTCTGGACGCAGTAAACTCGAGTTTACTGCGTCCAGACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005161.4-1534s21c1
Sequence:CCGGGAGAACAGATGCACGAGAAATCTCGAGATTTCTCGTGCATCTGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005161.2-961s1c1
Sequence:CCGGGCTGACCTGTTACTTCTTCATCTCGAGATGAAGAAGTAACAGGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005161.2-628s1c1
Sequence:CCGGCTACCTCATCTTCGTCAACATCTCGAGATGTTGACGAAGATGAGGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008097    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005161.2-1579s1c1
Sequence:CCGGGCTTCTAGAAGGGAAGAAATTCTCGAGAATTTCTTCCCTTCTAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005161.2-1393s1c1
Sequence:CCGGTGGAGAACAGATGCACGAGAACTCGAGTTCTCGTGCATCTGTTCTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005161.2-494s1c1
Sequence:CCGGCGCTCAGCTGATATCTTCATTCTCGAGAATGAAGATATCAGCTGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005161
APLNR MISSION shRNA Lentiviral Transduction Particles
apelin receptor
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356634    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005161.4-1934s21c1
Sequence:CCGGTTAGATCTGCAATCGTCTTTCCTCGAGGAAAGACGATTGCAGATCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356636    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005161.4-1889s21c1
Sequence:CCGGCCTGAGTCTGGACGCAGTAAACTCGAGTTTACTGCGTCCAGACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005161.4-1534s21c1
Sequence:CCGGGAGAACAGATGCACGAGAAATCTCGAGATTTCTCGTGCATCTGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005161.2-961s1c1
Sequence:CCGGGCTGACCTGTTACTTCTTCATCTCGAGATGAAGAAGTAACAGGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005161.2-628s1c1
Sequence:CCGGCTACCTCATCTTCGTCAACATCTCGAGATGTTGACGAAGATGAGGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008097    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005161.2-1579s1c1
Sequence:CCGGGCTTCTAGAAGGGAAGAAATTCTCGAGAATTTCTTCCCTTCTAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005161.2-1393s1c1
Sequence:CCGGTGGAGAACAGATGCACGAGAACTCGAGTTCTCGTGCATCTGTTCTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005161.2-494s1c1
Sequence:CCGGCGCTCAGCTGATATCTTCATTCTCGAGAATGAAGATATCAGCTGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks