EMAIL THIS PAGE TO A FRIEND

APLP2

amyloid beta (A4) precursor-like protein 2

186 Gene Product Result for
Synonyms: APLP-2 APPH APPL2 CDEBP
Gene ID:
Human(334) Summary: This gene encodes amyloid precursor- like protein 2 (APLP2), which is a member of the APP (amyloid precursor protein) family including APP, APLP1 and APLP2. This protein is ubiquitously expressed. It contains heparin-, copper- and zinc- binding domains at the N-terminus, BPTI/Kunitz inhibitor and E2 domains in the middle region, and transmembrane and intracellular domains at the C-terminus. This protein interacts with major histocompatibility complex (MHC) class I molecules. The synergy of this protein and the APP is required to mediate neuromuscular transmission, spatial learning and synaptic plasticity. This protein has been implicated in the pathogenesis of Alzheimer's disease. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
Mouse(11804) amyloid beta (A4) precursor-like protein 2
Rat(64312) amyloid beta (A4) precursor-like protein 2
naked mole-rat(101696833) amyloid beta (A4) precursor-like protein 2
domestic guinea pig(100713756) amyloid beta (A4) precursor-like protein 2
sheep(101119774) amyloid beta (A4) precursor-like protein 2
Domestic Rabbit(100358231) amyloid beta (A4) precursor-like protein 2
Zebrafish(796801) amyloid beta (A4) precursor-like protein 2
chicken(419727) amyloid beta (A4) precursor-like protein 2
dog(479393) amyloid beta (A4) precursor-like protein 2
cow(785005) amyloid beta (A4) precursor-like protein 2
Horse(100072668) amyloid beta (A4) precursor-like protein 2
Horse(100068170) amyloid beta (A4) precursor-like protein 2
domestic cat(101095518) amyloid beta (A4) precursor-like protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001642 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001642 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001642 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009691 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009691 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009691 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001642 Rosetta Predictions human pricing
XM_001055798 Rosetta Predictions rat pricing
XM_001055858 Rosetta Predictions rat pricing
XM_001055911 Rosetta Predictions rat pricing
XM_001055967 Rosetta Predictions rat pricing
XM_001056031 Rosetta Predictions rat pricing
XM_001056087 Rosetta Predictions rat pricing
XM_001056156 Rosetta Predictions rat pricing
XM_001056214 Rosetta Predictions rat pricing
XM_001056279 Rosetta Predictions rat pricing
XM_343513 Rosetta Predictions rat pricing
NM_001102455 Rosetta Predictions mouse pricing
NM_001102456 Rosetta Predictions mouse pricing
NM_009691 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001642 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070163 predicted 1582
2 SASI_Hs01_00070164 predicted 2138
3 SASI_Hs01_00070166 predicted 380
4 SASI_Hs01_00070167 predicted 366
5 SASI_Hs01_00070168 predicted 1655
6 SASI_Hs01_00070169 predicted 968
7 SASI_Hs01_00070170 predicted 972
8 SASI_Hs01_00070171 predicted 1742
9 SASI_Hs01_00070172 predicted 1656
10 SASI_Hs02_00332234 predicted 2042
11 SASI_Hs01_00070165 predicted 1795
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055798 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00281045 predicted 1209
2 SASI_Rn02_00281046 predicted 1570
3 SASI_Rn02_00281047 predicted 1032
4 SASI_Rn02_00281048 predicted 912
5 SASI_Rn02_00281049 predicted 1860
6 SASI_Rn02_00281050 predicted 1624
7 SASI_Rn02_00281051 predicted 211
8 SASI_Rn02_00281052 predicted 1149
9 SASI_Rn02_00281053 predicted 307
10 SASI_Rn02_00281054 predicted 1284
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055858 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00281248 predicted 2270
2 SASI_Rn02_00281249 predicted 1728
3 SASI_Rn02_00281250 predicted 1555
4 SASI_Rn02_00281251 predicted 2564
5 SASI_Rn02_00281252 predicted 2325
6 SASI_Rn02_00281253 predicted 1850
7 SASI_Rn02_00281254 predicted 955
8 SASI_Rn02_00281255 predicted 1986
9 SASI_Rn02_00281256 predicted 1677
10 SASI_Rn02_00281257 predicted 2663
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055911 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00281369 predicted 1716
2 SASI_Rn02_00281370 predicted 2072
3 SASI_Rn02_00281371 predicted 2359
4 SASI_Rn02_00281372 predicted 2123
5 SASI_Rn02_00281373 predicted 864
6 SASI_Rn02_00281374 predicted 1654
7 SASI_Rn02_00281375 predicted 955
8 SASI_Rn02_00281376 predicted 952
9 SASI_Rn02_00281377 predicted 1783
10 SASI_Rn02_00281378 predicted 2467
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055967 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00281614 predicted 1696
2 SASI_Rn02_00281615 predicted 2050
3 SASI_Rn02_00281616 predicted 2376
4 SASI_Rn02_00281617 predicted 2104
5 SASI_Rn02_00281618 predicted 862
6 SASI_Rn02_00281619 predicted 1635
7 SASI_Rn02_00281620 predicted 950
8 SASI_Rn02_00281621 predicted 953
9 SASI_Rn02_00281622 predicted 1761
10 SASI_Rn02_00281623 predicted 2480
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056031 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00281794 predicted 2271
2 SASI_Rn02_00281795 predicted 1741
3 SASI_Rn02_00281796 predicted 1565
4 SASI_Rn02_00281797 predicted 2568
5 SASI_Rn02_00281798 predicted 2328
6 SASI_Rn02_00281799 predicted 1863
7 SASI_Rn02_00281800 predicted 953
8 SASI_Rn02_00281801 predicted 1986
9 SASI_Rn02_00281802 predicted 1684
10 SASI_Rn02_00281803 predicted 2676
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056087 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00281954 predicted 1693
2 SASI_Rn02_00281955 predicted 2051
3 SASI_Rn02_00281956 predicted 2339
4 SASI_Rn02_00281957 predicted 2109
5 SASI_Rn02_00281958 predicted 863
6 SASI_Rn02_00281959 predicted 1628
7 SASI_Rn02_00281960 predicted 953
8 SASI_Rn02_00281961 predicted 960
9 SASI_Rn02_00281962 predicted 1762
10 SASI_Rn02_00281963 predicted 2448
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056156 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00282274 predicted 2209
2 SASI_Rn02_00282275 predicted 1676
3 SASI_Rn02_00282276 predicted 1558
4 SASI_Rn02_00282277 predicted 2498
5 SASI_Rn02_00282278 predicted 2267
6 SASI_Rn02_00282279 predicted 857
7 SASI_Rn02_00282280 predicted 1795
8 SASI_Rn02_00282281 predicted 947
9 SASI_Rn02_00282282 predicted 1926
10 SASI_Rn02_00282283 predicted 2605
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056214 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00282468 predicted 2218
2 SASI_Rn02_00282469 predicted 1676
3 SASI_Rn02_00282470 predicted 1562
4 SASI_Rn02_00282471 predicted 2545
5 SASI_Rn02_00282472 predicted 2270
6 SASI_Rn02_00282473 predicted 856
7 SASI_Rn02_00282474 predicted 1805
8 SASI_Rn02_00282475 predicted 951
9 SASI_Rn02_00282476 predicted 1925
10 SASI_Rn02_00282477 predicted 2645
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056279 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00282765 predicted 2216
2 SASI_Rn02_00282766 predicted 1681
3 SASI_Rn02_00282767 predicted 1565
4 SASI_Rn02_00282768 predicted 2502
5 SASI_Rn02_00282769 predicted 2277
6 SASI_Rn02_00282770 predicted 860
7 SASI_Rn02_00282771 predicted 1800
8 SASI_Rn02_00282772 predicted 951
9 SASI_Rn02_00282773 predicted 1932
10 SASI_Rn02_00282774 predicted 2610
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343513 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395964 predicted 1247
2 SASI_Rn02_00395965 predicted 1600
3 SASI_Rn02_00395966 predicted 1070
4 SASI_Rn02_00395967 predicted 231
5 SASI_Rn02_00395968 predicted 948
6 SASI_Rn02_00395969 predicted 1931
7 SASI_Rn02_00395970 predicted 1656
8 SASI_Rn02_00395971 predicted 1188
9 SASI_Rn02_00395972 predicted 1312
10 SASI_Rn02_00395973 predicted 2034
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102455 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00302863 predicted 1382
2 SASI_Mm02_00302864 predicted 2130
3 SASI_Mm02_00302865 predicted 1600
4 SASI_Mm02_00302866 predicted 2141
5 SASI_Mm02_00302867 predicted 477
6 SASI_Mm02_00302868 predicted 2155
7 SASI_Mm02_00302869 predicted 330
8 SASI_Mm02_00302870 predicted 481
9 SASI_Mm02_00302871 predicted 2127
10 SASI_Mm02_00302872 predicted 350
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102456 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00302873 predicted 1209
2 SASI_Mm02_00302874 predicted 1992
3 SASI_Mm02_00302875 predicted 1430
4 SASI_Mm02_00302876 predicted 2011
5 SASI_Mm02_00302877 predicted 474
6 SASI_Mm02_00302878 predicted 2025
7 SASI_Mm02_00302879 predicted 330
8 SASI_Mm02_00302880 predicted 481
9 SASI_Mm02_00302881 predicted 1995
10 SASI_Mm02_00302882 predicted 349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009691 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316787 predicted 1211
2 SASI_Mm01_00063499 predicted 1955
3 SASI_Mm01_00063500 predicted 1424
4 SASI_Mm02_00316788 predicted 1973
5 SASI_Mm01_00063503 predicted 475
6 SASI_Mm01_00063507 predicted 1989
7 SASI_Mm02_00316789 predicted 326
8 SASI_Mm02_00316790 predicted 483
9 SASI_Mm02_00316791 predicted 1958
10 SASI_Mm02_00316792 predicted 351
11 SASI_Mm01_00063498 predicted 1566
12 SASI_Mm01_00063501 predicted 1861
13 SASI_Mm01_00063502 predicted 462
14 SASI_Mm01_00063504 predicted 1135
15 SASI_Mm01_00063505 predicted 1931
16 SASI_Mm01_00063506 predicted 1594
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001642
VALIDATED
APLP2 MISSION shRNA Bacterial Glycerol Stock
amyloid beta (A4) precursor-like protein 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001642.2-2069s21c1
Sequence:CCGGGCCGAAGAGAAAGTGATTAACCTCGAGGTTAATCACTTTCTCTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001642.2-684s21c1
Sequence:CCGGCTCAGGGAATGACCTTATATACTCGAGTATATAAGGTCATTCCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001642.2-1454s21c1
Sequence:CCGGCACTTCCAAGCCATGGTTAAACTCGAGTTTAACCATGGCTTGGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001642.2-2428s21c1
Sequence:CCGGCCTGGAGCAGATGCAGATTTACTCGAGTAAATCTGCATCTGCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001642.2-2569s21c1
Sequence:CCGGTGGACTGTAGGACTATATAAACTCGAGTTTATATAGTCCTACAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001642.1-1184s1c1
Sequence:CCGGCCAATGATGTTGATGTGTATTCTCGAGAATACACATCAACATCATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001642.1-393s1c1
Sequence:CCGGCCAGCGGGTTAGTATTGACAACTCGAGTTGTCAATACTAACCCGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001642.1-2343s1c1
Sequence:CCGGCCTGGAGCAGATGCAGATTTACTCGAGTAAATCTGCATCTGCTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001642.1-1582s1c1
Sequence:CCGGCGCTTACATACCATCCGTCATCTCGAGATGACGGATGGTATGTAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001642
VALIDATED
APLP2 MISSION shRNA shRNA Plasmid DNA
amyloid beta (A4) precursor-like protein 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001642.2-2069s21c1
Sequence:CCGGGCCGAAGAGAAAGTGATTAACCTCGAGGTTAATCACTTTCTCTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001642.2-684s21c1
Sequence:CCGGCTCAGGGAATGACCTTATATACTCGAGTATATAAGGTCATTCCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001642.2-1454s21c1
Sequence:CCGGCACTTCCAAGCCATGGTTAAACTCGAGTTTAACCATGGCTTGGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001642.2-2428s21c1
Sequence:CCGGCCTGGAGCAGATGCAGATTTACTCGAGTAAATCTGCATCTGCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001642.2-2569s21c1
Sequence:CCGGTGGACTGTAGGACTATATAAACTCGAGTTTATATAGTCCTACAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001642.1-1184s1c1
Sequence:CCGGCCAATGATGTTGATGTGTATTCTCGAGAATACACATCAACATCATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001642.1-393s1c1
Sequence:CCGGCCAGCGGGTTAGTATTGACAACTCGAGTTGTCAATACTAACCCGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001642.1-2343s1c1
Sequence:CCGGCCTGGAGCAGATGCAGATTTACTCGAGTAAATCTGCATCTGCTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001642.1-1582s1c1
Sequence:CCGGCGCTTACATACCATCCGTCATCTCGAGATGACGGATGGTATGTAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001642
VALIDATED
APLP2 MISSION shRNA Lentiviral Transduction Particles
amyloid beta (A4) precursor-like protein 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001642.2-2069s21c1
Sequence:CCGGGCCGAAGAGAAAGTGATTAACCTCGAGGTTAATCACTTTCTCTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001642.2-684s21c1
Sequence:CCGGCTCAGGGAATGACCTTATATACTCGAGTATATAAGGTCATTCCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001642.2-1454s21c1
Sequence:CCGGCACTTCCAAGCCATGGTTAAACTCGAGTTTAACCATGGCTTGGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001642.2-2428s21c1
Sequence:CCGGCCTGGAGCAGATGCAGATTTACTCGAGTAAATCTGCATCTGCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001642.2-2569s21c1
Sequence:CCGGTGGACTGTAGGACTATATAAACTCGAGTTTATATAGTCCTACAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001642.1-1184s1c1
Sequence:CCGGCCAATGATGTTGATGTGTATTCTCGAGAATACACATCAACATCATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001642.1-393s1c1
Sequence:CCGGCCAGCGGGTTAGTATTGACAACTCGAGTTGTCAATACTAACCCGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001642.1-2343s1c1
Sequence:CCGGCCTGGAGCAGATGCAGATTTACTCGAGTAAATCTGCATCTGCTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001642.1-1582s1c1
Sequence:CCGGCGCTTACATACCATCCGTCATCTCGAGATGACGGATGGTATGTAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009691
VALIDATED
APLP2 MISSION shRNA Bacterial Glycerol Stock
amyloid beta (A4) precursor-like protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080048    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009691.1-2295s1c1
Sequence:CCGGCCTGGATTGTTAAGACTATAACTCGAGTTATAGTCTTAACAATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009691.1-274s1c1
Sequence:CCGGGTGAACATTCAGACTGGCAAACTCGAGTTTGCCAGTCTGAATGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009691.1-1431s1c1
Sequence:CCGGCCTGCATACCATTCGTCATTACTCGAGTAATGACGAATGGTATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009691.1-1625s1c1
Sequence:CCGGGAGCGGATATGGACCAATTTACTCGAGTAAATTGGTCCATATCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009691.1-1624s1c1
Sequence:CCGGCGAGCGGATATGGACCAATTTCTCGAGAAATTGGTCCATATCCGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009691
VALIDATED
APLP2 MISSION shRNA shRNA Plasmid DNA
amyloid beta (A4) precursor-like protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080048    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009691.1-2295s1c1
Sequence:CCGGCCTGGATTGTTAAGACTATAACTCGAGTTATAGTCTTAACAATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009691.1-274s1c1
Sequence:CCGGGTGAACATTCAGACTGGCAAACTCGAGTTTGCCAGTCTGAATGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009691.1-1431s1c1
Sequence:CCGGCCTGCATACCATTCGTCATTACTCGAGTAATGACGAATGGTATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009691.1-1625s1c1
Sequence:CCGGGAGCGGATATGGACCAATTTACTCGAGTAAATTGGTCCATATCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009691.1-1624s1c1
Sequence:CCGGCGAGCGGATATGGACCAATTTCTCGAGAAATTGGTCCATATCCGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009691
VALIDATED
APLP2 MISSION shRNA Lentiviral Transduction Particles
amyloid beta (A4) precursor-like protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080048    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009691.1-2295s1c1
Sequence:CCGGCCTGGATTGTTAAGACTATAACTCGAGTTATAGTCTTAACAATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009691.1-274s1c1
Sequence:CCGGGTGAACATTCAGACTGGCAAACTCGAGTTTGCCAGTCTGAATGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009691.1-1431s1c1
Sequence:CCGGCCTGCATACCATTCGTCATTACTCGAGTAATGACGAATGGTATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009691.1-1625s1c1
Sequence:CCGGGAGCGGATATGGACCAATTTACTCGAGTAAATTGGTCCATATCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009691.1-1624s1c1
Sequence:CCGGCGAGCGGATATGGACCAATTTCTCGAGAAATTGGTCCATATCCGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks