EMAIL THIS PAGE TO A FRIEND

APOA1

apolipoprotein A-I

75 Gene Product Result for
UniProtKB ID: P02647, A8K866, Q6LDN9, Q6Q785, Q9UCS8, Q9UCT8
Gene ID:
Human(335) Summary: This gene encodes apolipoprotein A-I, which is the major protein component of high density lipoprotein (HDL) in plasma. The protein promotes cholesterol efflux from tissues to the liver for excretion, and it is a cofactor for lecithin cholesterolacyltransferase (LCAT) which is responsible for the formation of most plasma cholesteryl esters. This gene is closely linked with two other apolipoprotein genes on chromosome 11. Defects in this gene are associated with HDL deficiencies, including Tangier disease, and with systemic non-neuropathic amyloidosis. [provided by RefSeq, Jul 2008]
Mouse(11806) apolipoprotein A-I
Rat(25081) apolipoprotein A-I
chicken(396536) apolipoprotein A-I
dog(479427) apolipoprotein A-I
domestic cat(101081076) apolipoprotein A-I
cow(281631) apolipoprotein A-I
naked mole-rat(101725714) apolipoprotein A-I
domestic guinea pig(100729378) apolipoprotein A-I
sheep(443373) apolipoprotein A-I
Domestic Rabbit(100009253) apolipoprotein A-I
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1104904 Anti-APOA1 (46-60) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB3500270 Anti-ApoA1 antibody produced in chicken affinity isolated antibody, buffered aqueous solution mouse, human, rat
ELISA, immunofluorescence, western blot pricing
GW20069F Anti-APOA1 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB2502171 Anti-APOA1 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB1405471 Anti-APOA1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA046715 Anti-APOA1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB2107051 Anti-APOA1 antibody produced in rabbit affinity isolated antibody rabbit, horse, rat, human
ELISA, western blot pricing
SAB1410670 Anti-APOA1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
WH0000335M1 Monoclonal Anti-APOA1 antibody produced in mouse clone 3A11-1A9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5300518 Monoclonal Anti-APOA1 antibody produced in mouse clone 5F4F5, ascites fluid human
ELISA, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB0607 Human APOA1 / Apolipoprotein A-I ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000039 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000039 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000039 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009692 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009692 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009692 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000039 Rosetta Predictions human pricing
NM_012738 Rosetta Predictions rat pricing
NM_009692 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000039 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022367 predicted 267
2 SASI_Hs01_00022368 predicted 197
3 SASI_Hs02_00301729 predicted 264
4 SASI_Hs02_00301730 predicted 236
5 SASI_Hs02_00301731 predicted 268
6 SASI_Hs01_00022362 predicted 635
7 SASI_Hs01_00022363 predicted 452
8 SASI_Hs01_00022364 predicted 446
9 SASI_Hs01_00022369 predicted 292
10 SASI_Hs01_00022370 predicted 289
11 SASI_Hs01_00022365 predicted 660
12 SASI_Hs01_00022366 predicted 407
13 SASI_Hs01_00022371 predicted 301
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012738 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044318 predicted 263
2 SASI_Rn01_00044319 predicted 503
3 SASI_Rn01_00044321 predicted 346
4 SASI_Rn01_00044322 predicted 493
5 SASI_Rn01_00044323 predicted 225
6 SASI_Rn01_00044325 predicted 584
7 SASI_Rn01_00044326 predicted 646
8 SASI_Rn01_00044327 predicted 209
9 SASI_Rn02_00260087 predicted 570
10 SASI_Rn02_00260088 predicted 501
11 SASI_Rn01_00044320 predicted 603
12 SASI_Rn01_00044324 predicted 454
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009692 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115229 predicted 361
2 SASI_Mm01_00115230 predicted 338
3 SASI_Mm02_00316793 predicted 491
4 SASI_Mm01_00115233 predicted 285
5 SASI_Mm02_00316794 predicted 214
6 SASI_Mm01_00115237 predicted 482
7 SASI_Mm02_00316795 predicted 226
8 SASI_Mm02_00316796 predicted 373
9 SASI_Mm02_00316797 predicted 298
10 SASI_Mm02_00316798 predicted 382
11 SASI_Mm01_00115228 predicted 206
12 SASI_Mm01_00115231 predicted 584
13 SASI_Mm01_00115232 predicted 350
14 SASI_Mm01_00115234 predicted 576
15 SASI_Mm01_00115235 predicted 237
16 SASI_Mm01_00115236 predicted 679
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000039
APOA1 MISSION shRNA Bacterial Glycerol Stock
apolipoprotein A-I
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000039.1-509s21c1
Sequence:CCGGGCTGCACGAGCTGCAAGAGAACTCGAGTTCTCTTGCAGCTCGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000039.1-366s21c1
Sequence:CCGGATGAGCAAGGATCTGGAGGAGCTCGAGCTCCTCCAGATCCTTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000039.1-319s21c1
Sequence:CCGGAGTTCTGGGATAACCTGGAAACTCGAGTTTCCAGGTTATCCCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000039.1-90s1c1
Sequence:CCGGGCTCGGCATTTCTGGCAGCAACTCGAGTTGCTGCCAGAAATGCCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000039.1-231s1c1
Sequence:CCGGCAGCTAAACCTAAAGCTCCTTCTCGAGAAGGAGCTTTAGGTTTAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000039.1-159s1c1
Sequence:CCGGGTGTACGTGGATGTGCTCAAACTCGAGTTTGAGCACATCCACGTACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000039.1-192s1c1
Sequence:CCGGGACTATGTGTCCCAGTTTGAACTCGAGTTCAAACTGGGACACATAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000039.1-674s1c1
Sequence:CCGGACTGGCCGAGTACCACGCCAACTCGAGTTGGCGTGGTACTCGGCCAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000039
APOA1 MISSION shRNA shRNA Plasmid DNA
apolipoprotein A-I
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000039.1-509s21c1
Sequence:CCGGGCTGCACGAGCTGCAAGAGAACTCGAGTTCTCTTGCAGCTCGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000039.1-366s21c1
Sequence:CCGGATGAGCAAGGATCTGGAGGAGCTCGAGCTCCTCCAGATCCTTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000039.1-319s21c1
Sequence:CCGGAGTTCTGGGATAACCTGGAAACTCGAGTTTCCAGGTTATCCCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000039.1-90s1c1
Sequence:CCGGGCTCGGCATTTCTGGCAGCAACTCGAGTTGCTGCCAGAAATGCCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000039.1-231s1c1
Sequence:CCGGCAGCTAAACCTAAAGCTCCTTCTCGAGAAGGAGCTTTAGGTTTAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000039.1-159s1c1
Sequence:CCGGGTGTACGTGGATGTGCTCAAACTCGAGTTTGAGCACATCCACGTACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000039.1-192s1c1
Sequence:CCGGGACTATGTGTCCCAGTTTGAACTCGAGTTCAAACTGGGACACATAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000039.1-674s1c1
Sequence:CCGGACTGGCCGAGTACCACGCCAACTCGAGTTGGCGTGGTACTCGGCCAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000039
APOA1 MISSION shRNA Lentiviral Transduction Particles
apolipoprotein A-I
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000039.1-509s21c1
Sequence:CCGGGCTGCACGAGCTGCAAGAGAACTCGAGTTCTCTTGCAGCTCGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000039.1-366s21c1
Sequence:CCGGATGAGCAAGGATCTGGAGGAGCTCGAGCTCCTCCAGATCCTTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000039.1-319s21c1
Sequence:CCGGAGTTCTGGGATAACCTGGAAACTCGAGTTTCCAGGTTATCCCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000039.1-90s1c1
Sequence:CCGGGCTCGGCATTTCTGGCAGCAACTCGAGTTGCTGCCAGAAATGCCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000039.1-231s1c1
Sequence:CCGGCAGCTAAACCTAAAGCTCCTTCTCGAGAAGGAGCTTTAGGTTTAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000039.1-159s1c1
Sequence:CCGGGTGTACGTGGATGTGCTCAAACTCGAGTTTGAGCACATCCACGTACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000039.1-192s1c1
Sequence:CCGGGACTATGTGTCCCAGTTTGAACTCGAGTTCAAACTGGGACACATAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000039.1-674s1c1
Sequence:CCGGACTGGCCGAGTACCACGCCAACTCGAGTTGGCGTGGTACTCGGCCAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009692
APOA1 MISSION shRNA Bacterial Glycerol Stock
apolipoprotein A-I
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009692.1-666s1c1
Sequence:CCGGCAACCCTACCTTGAACGAGTACTCGAGTACTCGTTCAAGGTAGGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009692.1-195s1c1
Sequence:CCGGCAGAGACTATGTGTCCCAGTTCTCGAGAACTGGGACACATAGTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009692.1-196s1c1
Sequence:CCGGAGAGACTATGTGTCCCAGTTTCTCGAGAAACTGGGACACATAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009692.1-753s1c1
Sequence:CCGGGCGCCATAGTCTGATGCCCATCTCGAGATGGGCATCAGACTATGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009692.1-408s1c1
Sequence:CCGGGCAGCCCTACCTGGACGAATTCTCGAGAATTCGTCCAGGTAGGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009692
APOA1 MISSION shRNA shRNA Plasmid DNA
apolipoprotein A-I
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009692.1-666s1c1
Sequence:CCGGCAACCCTACCTTGAACGAGTACTCGAGTACTCGTTCAAGGTAGGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009692.1-195s1c1
Sequence:CCGGCAGAGACTATGTGTCCCAGTTCTCGAGAACTGGGACACATAGTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009692.1-196s1c1
Sequence:CCGGAGAGACTATGTGTCCCAGTTTCTCGAGAAACTGGGACACATAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009692.1-753s1c1
Sequence:CCGGGCGCCATAGTCTGATGCCCATCTCGAGATGGGCATCAGACTATGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009692.1-408s1c1
Sequence:CCGGGCAGCCCTACCTGGACGAATTCTCGAGAATTCGTCCAGGTAGGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009692
APOA1 MISSION shRNA Lentiviral Transduction Particles
apolipoprotein A-I
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009692.1-666s1c1
Sequence:CCGGCAACCCTACCTTGAACGAGTACTCGAGTACTCGTTCAAGGTAGGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009692.1-195s1c1
Sequence:CCGGCAGAGACTATGTGTCCCAGTTCTCGAGAACTGGGACACATAGTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009692.1-196s1c1
Sequence:CCGGAGAGACTATGTGTCCCAGTTTCTCGAGAAACTGGGACACATAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009692.1-753s1c1
Sequence:CCGGGCGCCATAGTCTGATGCCCATCTCGAGATGGGCATCAGACTATGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009692.1-408s1c1
Sequence:CCGGGCAGCCCTACCTGGACGAATTCTCGAGAATTCGTCCAGGTAGGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks