EMAIL THIS PAGE TO A FRIEND

APOA1BP

apolipoprotein A-I binding protein

77 Gene Product Result for
Synonyms: AIBP YJEFN1
UniProtKB ID: Q8NCW5, B4DGY3, Q496C6, Q5T3I2
Gene ID:
Human(128240) Summary: The product of this gene interacts with apolipoprotein A-I (apoA-I), the major apolipoprotein of high-density lipoproteins (HDLs). It is secreted into some bodily fluids, and its synthesis and secretion are stimulated in vitro by incubating cells with apoA-I. The human genome contains related pseudogenes. [provided by RefSeq, Jul 2008]
Mouse(246703) apolipoprotein A-I binding protein
Rat(295229) apolipoprotein A-I binding protein
Zebrafish(436891) apolipoprotein A-I binding protein
cow(404132) apolipoprotein A-I binding protein
domestic cat(101083904) apolipoprotein A-I binding protein
dog(612116) apolipoprotein A-I binding protein
chicken(426569) apolipoprotein A-I binding protein
sheep(101105295) apolipoprotein A-I binding protein
domestic guinea pig(100724227) apolipoprotein A-I binding protein
naked mole-rat(101716392) apolipoprotein A-I binding protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144772 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144772 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144772 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144897 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144897 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144897 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU033771 MISSION® esiRNA esiRNA human APOA1BP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144772 Rosetta Predictions human pricing
NM_001106440 Rosetta Predictions rat pricing
NM_144897 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144772 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200056 predicted 741
2 SASI_Hs01_00200057 predicted 671
3 SASI_Hs01_00200058 predicted 780
4 SASI_Hs01_00200059 predicted 872
5 SASI_Hs01_00200060 predicted 481
6 SASI_Hs01_00200062 predicted 613
7 SASI_Hs01_00200063 predicted 434
8 SASI_Hs01_00200064 predicted 412
9 SASI_Hs01_00200065 predicted 305
10 SASI_Hs02_00364718 predicted 316
11 SASI_Hs01_00200061 predicted 256
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106440 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218978 predicted 685
2 SASI_Rn02_00218979 predicted 576
3 SASI_Rn02_00218980 predicted 549
4 SASI_Rn02_00218981 predicted 531
5 SASI_Rn02_00218982 predicted 650
6 SASI_Rn02_00218983 predicted 644
7 SASI_Rn02_00218984 predicted 612
8 SASI_Rn02_00218985 predicted 523
9 SASI_Rn02_00218986 predicted 764
10 SASI_Rn02_00218987 predicted 605
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144897 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132571 predicted 468
2 SASI_Mm02_00340353 predicted 425
3 SASI_Mm01_00132573 predicted 617
4 SASI_Mm01_00132574 predicted 259
5 SASI_Mm02_00340354 predicted 611
6 SASI_Mm01_00132575 predicted 638
7 SASI_Mm01_00132576 predicted 445
8 SASI_Mm02_00340355 predicted 496
9 SASI_Mm02_00340356 predicted 464
10 SASI_Mm01_00132577 predicted 438
11 SASI_Mm01_00132570 predicted 677
12 SASI_Mm01_00132572 predicted 683
13 SASI_Mm01_00132578 predicted 620
14 SASI_Mm01_00132579 predicted 256
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144772
APOA1BP MISSION shRNA Bacterial Glycerol Stock
apolipoprotein A-I binding protein
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144772.1-264s1c1
Sequence:CCGGCGTGGACCAACTTATGGAACTCTCGAGAGTTCCATAAGTTGGTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144772.1-409s1c1
Sequence:CCGGGCTCGACACCTCAAACTCTTTCTCGAGAAAGAGTTTGAGGTGTCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144772.1-541s1c1
Sequence:CCGGGAGCCCATGACGATTGATGAACTCGAGTTCATCAATCGTCATGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144772.1-777s1c1
Sequence:CCGGGTTTACCGGTCGCTACCATTACTCGAGTAATGGTAGCGACCGGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144772.1-543s1c1
Sequence:CCGGGCCCATGACGATTGATGAACTCTCGAGAGTTCATCAATCGTCATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144772.1-431s1c1
Sequence:CCGGGCTACGAGCCAACCATCTATTCTCGAGAATAGATGGTTGGCTCGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144772.1-867s1c1
Sequence:CCGGCACTGAGTGTGTCTATCGTCTCTCGAGAGACGATAGACACACTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144772.1-413s1c1
Sequence:CCGGGACACCTCAAACTCTTTGGCTCTCGAGAGCCAAAGAGTTTGAGGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144772.1-545s1c1
Sequence:CCGGCCATGACGATTGATGAACTGTCTCGAGACAGTTCATCAATCGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150385    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144772.1-546s1c1
Sequence:CCGGCATGACGATTGATGAACTGTACTCGAGTACAGTTCATCAATCGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152509    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144772.1-232s1c1
Sequence:CCGGGACCAGGAGCTATTTAACGAACTCGAGTTCGTTAAATAGCTCCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144772
APOA1BP MISSION shRNA shRNA Plasmid DNA
apolipoprotein A-I binding protein
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144772.1-264s1c1
Sequence:CCGGCGTGGACCAACTTATGGAACTCTCGAGAGTTCCATAAGTTGGTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144772.1-409s1c1
Sequence:CCGGGCTCGACACCTCAAACTCTTTCTCGAGAAAGAGTTTGAGGTGTCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144772.1-541s1c1
Sequence:CCGGGAGCCCATGACGATTGATGAACTCGAGTTCATCAATCGTCATGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144772.1-777s1c1
Sequence:CCGGGTTTACCGGTCGCTACCATTACTCGAGTAATGGTAGCGACCGGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144772.1-543s1c1
Sequence:CCGGGCCCATGACGATTGATGAACTCTCGAGAGTTCATCAATCGTCATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144772.1-431s1c1
Sequence:CCGGGCTACGAGCCAACCATCTATTCTCGAGAATAGATGGTTGGCTCGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144772.1-867s1c1
Sequence:CCGGCACTGAGTGTGTCTATCGTCTCTCGAGAGACGATAGACACACTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144772.1-413s1c1
Sequence:CCGGGACACCTCAAACTCTTTGGCTCTCGAGAGCCAAAGAGTTTGAGGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144772.1-545s1c1
Sequence:CCGGCCATGACGATTGATGAACTGTCTCGAGACAGTTCATCAATCGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150385    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144772.1-546s1c1
Sequence:CCGGCATGACGATTGATGAACTGTACTCGAGTACAGTTCATCAATCGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152509    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144772.1-232s1c1
Sequence:CCGGGACCAGGAGCTATTTAACGAACTCGAGTTCGTTAAATAGCTCCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144772
APOA1BP MISSION shRNA Lentiviral Transduction Particles
apolipoprotein A-I binding protein
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144772.1-264s1c1
Sequence:CCGGCGTGGACCAACTTATGGAACTCTCGAGAGTTCCATAAGTTGGTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144772.1-409s1c1
Sequence:CCGGGCTCGACACCTCAAACTCTTTCTCGAGAAAGAGTTTGAGGTGTCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144772.1-541s1c1
Sequence:CCGGGAGCCCATGACGATTGATGAACTCGAGTTCATCAATCGTCATGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144772.1-777s1c1
Sequence:CCGGGTTTACCGGTCGCTACCATTACTCGAGTAATGGTAGCGACCGGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144772.1-543s1c1
Sequence:CCGGGCCCATGACGATTGATGAACTCTCGAGAGTTCATCAATCGTCATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144772.1-431s1c1
Sequence:CCGGGCTACGAGCCAACCATCTATTCTCGAGAATAGATGGTTGGCTCGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144772.1-867s1c1
Sequence:CCGGCACTGAGTGTGTCTATCGTCTCTCGAGAGACGATAGACACACTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144772.1-413s1c1
Sequence:CCGGGACACCTCAAACTCTTTGGCTCTCGAGAGCCAAAGAGTTTGAGGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144772.1-545s1c1
Sequence:CCGGCCATGACGATTGATGAACTGTCTCGAGACAGTTCATCAATCGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150385    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144772.1-546s1c1
Sequence:CCGGCATGACGATTGATGAACTGTACTCGAGTACAGTTCATCAATCGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152509    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144772.1-232s1c1
Sequence:CCGGGACCAGGAGCTATTTAACGAACTCGAGTTCGTTAAATAGCTCCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144897
VALIDATED
APOA1BP MISSION shRNA Bacterial Glycerol Stock
apolipoprotein A-I binding protein
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144897.1-150s1c1
Sequence:CCGGGCTGCGGTGAAGTACTTAAGTCTCGAGACTTAAGTACTTCACCGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144897.1-657s1c1
Sequence:CCGGGATGTAGAGAAGGGAAACCCTCTCGAGAGGGTTTCCCTTCTCTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144897.1-730s1c1
Sequence:CCGGCAACTCACTTTACTGGCCGATCTCGAGATCGGCCAGTAAAGTGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144897.1-545s1c1
Sequence:CCGGCATCTTCGGCTTCAGTTTCAACTCGAGTTGAAACTGAAGCCGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144897.3-545s21c1
Sequence:CCGGCATCTTCGGCTTCAGTTTCAACTCGAGTTGAAACTGAAGCCGAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144897.3-730s21c1
Sequence:CCGGCAACTCACTTTACTGGCCGATCTCGAGATCGGCCAGTAAAGTGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144897.3-150s21c1
Sequence:CCGGGCTGCGGTGAAGTACTTAAGTCTCGAGACTTAAGTACTTCACCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144897.3-657s21c1
Sequence:CCGGGATGTAGAGAAGGGAAACCCTCTCGAGAGGGTTTCCCTTCTCTACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144897
VALIDATED
APOA1BP MISSION shRNA shRNA Plasmid DNA
apolipoprotein A-I binding protein
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144897.1-150s1c1
Sequence:CCGGGCTGCGGTGAAGTACTTAAGTCTCGAGACTTAAGTACTTCACCGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144897.1-657s1c1
Sequence:CCGGGATGTAGAGAAGGGAAACCCTCTCGAGAGGGTTTCCCTTCTCTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144897.1-730s1c1
Sequence:CCGGCAACTCACTTTACTGGCCGATCTCGAGATCGGCCAGTAAAGTGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144897.1-545s1c1
Sequence:CCGGCATCTTCGGCTTCAGTTTCAACTCGAGTTGAAACTGAAGCCGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144897.3-545s21c1
Sequence:CCGGCATCTTCGGCTTCAGTTTCAACTCGAGTTGAAACTGAAGCCGAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144897.3-730s21c1
Sequence:CCGGCAACTCACTTTACTGGCCGATCTCGAGATCGGCCAGTAAAGTGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144897.3-150s21c1
Sequence:CCGGGCTGCGGTGAAGTACTTAAGTCTCGAGACTTAAGTACTTCACCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144897.3-657s21c1
Sequence:CCGGGATGTAGAGAAGGGAAACCCTCTCGAGAGGGTTTCCCTTCTCTACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144897
VALIDATED
APOA1BP MISSION shRNA Lentiviral Transduction Particles
apolipoprotein A-I binding protein
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144897.1-150s1c1
Sequence:CCGGGCTGCGGTGAAGTACTTAAGTCTCGAGACTTAAGTACTTCACCGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144897.1-657s1c1
Sequence:CCGGGATGTAGAGAAGGGAAACCCTCTCGAGAGGGTTTCCCTTCTCTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144897.1-730s1c1
Sequence:CCGGCAACTCACTTTACTGGCCGATCTCGAGATCGGCCAGTAAAGTGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144897.1-545s1c1
Sequence:CCGGCATCTTCGGCTTCAGTTTCAACTCGAGTTGAAACTGAAGCCGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144897.3-545s21c1
Sequence:CCGGCATCTTCGGCTTCAGTTTCAACTCGAGTTGAAACTGAAGCCGAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144897.3-730s21c1
Sequence:CCGGCAACTCACTTTACTGGCCGATCTCGAGATCGGCCAGTAAAGTGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144897.3-150s21c1
Sequence:CCGGGCTGCGGTGAAGTACTTAAGTCTCGAGACTTAAGTACTTCACCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144897.3-657s21c1
Sequence:CCGGGATGTAGAGAAGGGAAACCCTCTCGAGAGGGTTTCCCTTCTCTACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks