EMAIL THIS PAGE TO A FRIEND

APOA2

apolipoprotein A-II

66 Gene Product Result for
Synonyms: Apo-AII ApoA-II apoAII
UniProtKB ID: P02652, B2R524
Gene ID:
Human(336) Summary: This gene encodes apolipoprotein (apo-) A-II, which is the second most abundant protein of the high density lipoprotein particles. The protein is found in plasma as a monomer, homodimer, or heterodimer with apolipoprotein D. Defects in this gene may result in apolipoprotein A-II deficiency or hypercholesterolemia. [provided by RefSeq, Jul 2008]
Mouse(11807) apolipoprotein A-II
Rat(25649) apolipoprotein A-II
naked mole-rat(101701317) apolipoprotein A-II
domestic guinea pig(100713822) apolipoprotein A-II
sheep(101104619) apolipoprotein A-II
Zebrafish(322327) apolipoprotein A-II
dog(478982) apolipoprotein A-II
cow(505394) apolipoprotein A-II
domestic cat(101088715) apolipoprotein A-II
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0608 Human APOA2 / Apolipoprotein A-II ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001643 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001643 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001643 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013474 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013474 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013474 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001643 Rosetta Predictions human pricing
NM_013112 Rosetta Predictions rat pricing
NM_013474 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001643 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016866 predicted 230
2 SASI_Hs01_00016868 predicted 234
3 SASI_Hs01_00016869 predicted 222
4 SASI_Hs01_00016870 predicted 231
5 SASI_Hs01_00016872 predicted 204
6 SASI_Hs01_00016873 predicted 226
7 SASI_Hs01_00016874 predicted 225
8 SASI_Hs02_00332235 predicted 229
9 SASI_Hs01_00016867 predicted 216
10 SASI_Hs01_00016871 predicted 220
11 SASI_Hs01_00016875 predicted 223
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013112 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047929 predicted 370
2 SASI_Rn02_00260890 predicted 211
3 SASI_Rn01_00047931 predicted 182
4 SASI_Rn01_00047932 predicted 41
5 SASI_Rn01_00047933 predicted 205
6 SASI_Rn01_00047935 predicted 98
7 SASI_Rn01_00047936 predicted 371
8 SASI_Rn01_00047937 predicted 297
9 SASI_Rn01_00047938 predicted 122
10 SASI_Rn02_00260891 predicted 247
11 SASI_Rn01_00047930 predicted 250
12 SASI_Rn01_00047934 predicted 241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013474 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322104 predicted 219
2 SASI_Mm02_00322105 predicted 212
3 SASI_Mm02_00322106 predicted 255
4 SASI_Mm02_00322107 predicted 212
5 SASI_Mm02_00322108 predicted 274
6 SASI_Mm02_00322109 predicted 223
7 SASI_Mm02_00322110 predicted 202
8 SASI_Mm02_00322111 predicted 218
9 SASI_Mm02_00322112 predicted 234
10 SASI_Mm02_00322113 predicted 198
11 SASI_Mm01_00116153 predicted 240
12 SASI_Mm01_00116154 predicted 239
13 SASI_Mm01_00116155 predicted 237
14 SASI_Mm01_00116156 predicted 246
15 SASI_Mm01_00116157 predicted 213
16 SASI_Mm01_00116158 predicted 228
17 SASI_Mm01_00116159 predicted 248
18 SASI_Mm01_00116160 predicted 214
19 SASI_Mm01_00116161 predicted 252
20 SASI_Mm01_00116162 predicted 207
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001643
APOA2 MISSION shRNA Bacterial Glycerol Stock
apolipoprotein A-II
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001643.1-258s21c1
Sequence:CCGGAGTCAAAGGAGCAGCTGACACCTCGAGGTGTCAGCTGCTCCTTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001643.1-280s21c1
Sequence:CCGGCCTGATCAAGAAGGCTGGAACCTCGAGGTTCCAGCCTTCTTGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001643.1-171s21c1
Sequence:CCGGTCCAGACCGTGACTGACTATGCTCGAGCATAGTCAGTCACGGTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001643.1-233s1c1
Sequence:CCGGGCCGAGGCCAAGTCTTACTTTCTCGAGAAAGTAAGACTTGGCCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001643.1-321s1c1
Sequence:CCGGGCTATTTCGTGGAACTTGGAACTCGAGTTCCAAGTTCCACGAAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001643.1-97s1c1
Sequence:CCGGCTGCAGCCTTGAAGGAGCTTTCTCGAGAAAGCTCCTTCAAGGCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001643.1-140s1c1
Sequence:CCGGCCATGTGTGGAGAGCCTGGTTCTCGAGAACCAGGCTCTCCACACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001643.1-305s1c1
Sequence:CCGGCTGGTTAACTTCTTGAGCTATCTCGAGATAGCTCAAGAAGTTAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001643
APOA2 MISSION shRNA shRNA Plasmid DNA
apolipoprotein A-II
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001643.1-258s21c1
Sequence:CCGGAGTCAAAGGAGCAGCTGACACCTCGAGGTGTCAGCTGCTCCTTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001643.1-280s21c1
Sequence:CCGGCCTGATCAAGAAGGCTGGAACCTCGAGGTTCCAGCCTTCTTGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001643.1-171s21c1
Sequence:CCGGTCCAGACCGTGACTGACTATGCTCGAGCATAGTCAGTCACGGTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001643.1-233s1c1
Sequence:CCGGGCCGAGGCCAAGTCTTACTTTCTCGAGAAAGTAAGACTTGGCCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001643.1-321s1c1
Sequence:CCGGGCTATTTCGTGGAACTTGGAACTCGAGTTCCAAGTTCCACGAAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001643.1-97s1c1
Sequence:CCGGCTGCAGCCTTGAAGGAGCTTTCTCGAGAAAGCTCCTTCAAGGCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001643.1-140s1c1
Sequence:CCGGCCATGTGTGGAGAGCCTGGTTCTCGAGAACCAGGCTCTCCACACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001643.1-305s1c1
Sequence:CCGGCTGGTTAACTTCTTGAGCTATCTCGAGATAGCTCAAGAAGTTAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001643
APOA2 MISSION shRNA Lentiviral Transduction Particles
apolipoprotein A-II
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001643.1-258s21c1
Sequence:CCGGAGTCAAAGGAGCAGCTGACACCTCGAGGTGTCAGCTGCTCCTTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001643.1-280s21c1
Sequence:CCGGCCTGATCAAGAAGGCTGGAACCTCGAGGTTCCAGCCTTCTTGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001643.1-171s21c1
Sequence:CCGGTCCAGACCGTGACTGACTATGCTCGAGCATAGTCAGTCACGGTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001643.1-233s1c1
Sequence:CCGGGCCGAGGCCAAGTCTTACTTTCTCGAGAAAGTAAGACTTGGCCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001643.1-321s1c1
Sequence:CCGGGCTATTTCGTGGAACTTGGAACTCGAGTTCCAAGTTCCACGAAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001643.1-97s1c1
Sequence:CCGGCTGCAGCCTTGAAGGAGCTTTCTCGAGAAAGCTCCTTCAAGGCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001643.1-140s1c1
Sequence:CCGGCCATGTGTGGAGAGCCTGGTTCTCGAGAACCAGGCTCTCCACACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001643.1-305s1c1
Sequence:CCGGCTGGTTAACTTCTTGAGCTATCTCGAGATAGCTCAAGAAGTTAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013474
APOA2 MISSION shRNA Bacterial Glycerol Stock
apolipoprotein A-II
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013474.1-186s1c1
Sequence:CCGGTGACTGAATATGGCAAAGATTCTCGAGAATCTTTGCCATATTCAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013474.1-325s1c1
Sequence:CCGGCAGCAGTTTAATGAACCTCGACTCGAGTCGAGGTTCATTAAACTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013474.1-182s1c1
Sequence:CCGGAGCATGACTGAATATGGCAAACTCGAGTTTGCCATATTCAGTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013474.1-95s1c1
Sequence:CCGGGTAACCATCTGTAGCCTGGAACTCGAGTTCCAGGCTACAGATGGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013474.1-256s1c1
Sequence:CCGGCTTTGAGAAGACACACGAGCACTCGAGTGCTCGTGTGTCTTCTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013474
APOA2 MISSION shRNA shRNA Plasmid DNA
apolipoprotein A-II
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013474.1-186s1c1
Sequence:CCGGTGACTGAATATGGCAAAGATTCTCGAGAATCTTTGCCATATTCAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013474.1-325s1c1
Sequence:CCGGCAGCAGTTTAATGAACCTCGACTCGAGTCGAGGTTCATTAAACTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013474.1-182s1c1
Sequence:CCGGAGCATGACTGAATATGGCAAACTCGAGTTTGCCATATTCAGTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013474.1-95s1c1
Sequence:CCGGGTAACCATCTGTAGCCTGGAACTCGAGTTCCAGGCTACAGATGGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013474.1-256s1c1
Sequence:CCGGCTTTGAGAAGACACACGAGCACTCGAGTGCTCGTGTGTCTTCTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013474
APOA2 MISSION shRNA Lentiviral Transduction Particles
apolipoprotein A-II
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013474.1-186s1c1
Sequence:CCGGTGACTGAATATGGCAAAGATTCTCGAGAATCTTTGCCATATTCAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013474.1-325s1c1
Sequence:CCGGCAGCAGTTTAATGAACCTCGACTCGAGTCGAGGTTCATTAAACTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013474.1-182s1c1
Sequence:CCGGAGCATGACTGAATATGGCAAACTCGAGTTTGCCATATTCAGTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013474.1-95s1c1
Sequence:CCGGGTAACCATCTGTAGCCTGGAACTCGAGTTCCAGGCTACAGATGGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013474.1-256s1c1
Sequence:CCGGCTTTGAGAAGACACACGAGCACTCGAGTGCTCGTGTGTCTTCTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks