EMAIL THIS PAGE TO A FRIEND

APOA4

apolipoprotein A-IV

81 Gene Product Result for
UniProtKB ID: P06727, A8MSL6, Q14CW8, Q6Q787
Gene ID:
Human(337) Summary: Apoliprotein (apo) A-IV gene contains 3 exons separated by two introns. A sequence polymorphism has been identified in the 3'UTR of the third exon. The primary translation product is a 396-residue preprotein which after proteolytic processing is secreted its primary site of synthesis, the intestine, in association with chylomicron particles. Although its precise function is not known, apo A-IV is a potent activator of lecithin-cholesterol acyltransferase in vitro. [provided by RefSeq, Jul 2008]
Mouse(11808) apolipoprotein A-IV
Rat(25080) apolipoprotein A-IV
Zebrafish(322543) apolipoprotein A-IV
dog(489392) apolipoprotein A-IV
cow(537301) apolipoprotein A-IV
Horse(100062506) apolipoprotein A-IV
domestic cat(101080570) apolipoprotein A-IV
chicken(395780) apolipoprotein A-IV
sheep(101117014) apolipoprotein A-IV
Domestic Rabbit(100328797) apolipoprotein A-IV
domestic guinea pig(100732215) apolipoprotein A-IV
naked mole-rat(101724709) apolipoprotein A-IV
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2500078 Anti-APOA4 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB1405472 Anti-APOA4 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunohistochemistry, western blot pricing
HPA001352 Anti-APOA4 antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, human
immunohistochemistry pricing
AV54316 Anti-APOA4 antibody produced in rabbit affinity isolated antibody human
western blot pricing
HPA002549 Anti-APOA4 antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB1410673 Anti-APOA4 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB3500623 Anti-APOA4 antibody produced in rabbit affinity isolated antibody chicken, human
ELISA, western blot pricing
AMAB90769 Monoclonal Anti-APOA4 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0468, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AMAB90768 Monoclonal Anti-APOA4 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0467, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB5300149 Monoclonal Anti-APOA4 antibody produced in mouse clone 1D4C11, ascites fluid human
ELISA, western blot pricing
SAB5300150 Monoclonal Anti-APOA4 antibody produced in mouse clone 2D1C9, ascites fluid human
ELISA, western blot pricing
AMAB90767 Monoclonal Anti-APOA4 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0465, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0458 AQUA Peptide IDQTVEEL[R] human pricing
AQ0457 AQUA Peptide VNSFFSTF[K] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007468 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007468 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007468 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000482 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000482 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000482 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU107901 MISSION® esiRNA esiRNA human APOA4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000482 Rosetta Predictions human pricing
NM_012737 Rosetta Predictions rat pricing
NM_007468 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000482 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090399 predicted 913
2 SASI_Hs01_00090400 predicted 858
3 SASI_Hs01_00090401 predicted 755
4 SASI_Hs01_00090403 predicted 906
5 SASI_Hs01_00090404 predicted 782
6 SASI_Hs02_00302624 predicted 767
7 SASI_Hs02_00302625 predicted 762
8 SASI_Hs02_00302626 predicted 812
9 SASI_Hs01_00090408 predicted 814
10 SASI_Hs02_00302627 predicted 848
11 SASI_Hs01_00090402 predicted 719
12 SASI_Hs01_00090405 predicted 822
13 SASI_Hs01_00090406 predicted 725
14 SASI_Hs01_00090407 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012737 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083912 predicted 412
2 SASI_Rn01_00083913 predicted 273
3 SASI_Rn01_00083914 predicted 339
4 SASI_Rn01_00083915 predicted 435
5 SASI_Rn01_00083916 predicted 246
6 SASI_Rn01_00083917 predicted 904
7 SASI_Rn01_00083918 predicted 526
8 SASI_Rn01_00083919 predicted 576
9 SASI_Rn01_00083920 predicted 623
10 SASI_Rn01_00083921 predicted 1141
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007468 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124871 predicted 870
2 SASI_Mm02_00311680 predicted 439
3 SASI_Mm02_00311681 predicted 1318
4 SASI_Mm02_00311682 predicted 861
5 SASI_Mm02_00311683 predicted 1353
6 SASI_Mm02_00311684 predicted 425
7 SASI_Mm02_00311685 predicted 1349
8 SASI_Mm02_00311686 predicted 860
9 SASI_Mm01_00124864 predicted 802
10 SASI_Mm02_00311687 predicted 398
11 SASI_Mm01_00124862 predicted 278
12 SASI_Mm01_00124863 predicted 486
13 SASI_Mm01_00124865 predicted 242
14 SASI_Mm01_00124866 predicted 445
15 SASI_Mm01_00124867 predicted 250
16 SASI_Mm01_00124868 predicted 605
17 SASI_Mm01_00124869 predicted 618
18 SASI_Mm01_00124870 predicted 232
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007468
APOA4 MISSION shRNA Bacterial Glycerol Stock
apolipoprotein A-IV
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007468.1-548s1c1
Sequence:CCGGCCAACTTAAAGGACAAGTTTACTCGAGTAAACTTGTCCTTTAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007468.1-136s1c1
Sequence:CCGGGAACAGTTTCAGAAGACGGATCTCGAGATCCGTCTTCTGAAACTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007468.1-687s1c1
Sequence:CCGGGCAGGAGAAACTCAACCATCACTCGAGTGATGGTTGAGTTTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007468.1-348s1c1
Sequence:CCGGCAACAAAGTAACCCAGACGTTCTCGAGAACGTCTGGGTTACTTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007468.1-105s1c1
Sequence:CCGGCCAGCTAAGCAACAATGCCAACTCGAGTTGGCATTGTTGCTTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007468.2-396s21c1
Sequence:CCGGATGTGGTGTGGGATTACTTTACTCGAGTAAAGTAATCCCACACCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007468.2-1355s21c1
Sequence:CCGGGAGAAGGTCAACTCCTTTATGCTCGAGCATAAAGGAGTTGACCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007468.2-829s21c1
Sequence:CCGGCAACCTGCACACCTCGATGATCTCGAGATCATCGAGGTGTGCAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007468.2-564s21c1
Sequence:CCGGTACAGCTGAGTGGGCATCTAGCTCGAGCTAGATGCCCACTCAGCTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007468
APOA4 MISSION shRNA shRNA Plasmid DNA
apolipoprotein A-IV
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007468.1-548s1c1
Sequence:CCGGCCAACTTAAAGGACAAGTTTACTCGAGTAAACTTGTCCTTTAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007468.1-136s1c1
Sequence:CCGGGAACAGTTTCAGAAGACGGATCTCGAGATCCGTCTTCTGAAACTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007468.1-687s1c1
Sequence:CCGGGCAGGAGAAACTCAACCATCACTCGAGTGATGGTTGAGTTTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007468.1-348s1c1
Sequence:CCGGCAACAAAGTAACCCAGACGTTCTCGAGAACGTCTGGGTTACTTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007468.1-105s1c1
Sequence:CCGGCCAGCTAAGCAACAATGCCAACTCGAGTTGGCATTGTTGCTTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007468.2-396s21c1
Sequence:CCGGATGTGGTGTGGGATTACTTTACTCGAGTAAAGTAATCCCACACCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007468.2-1355s21c1
Sequence:CCGGGAGAAGGTCAACTCCTTTATGCTCGAGCATAAAGGAGTTGACCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007468.2-829s21c1
Sequence:CCGGCAACCTGCACACCTCGATGATCTCGAGATCATCGAGGTGTGCAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007468.2-564s21c1
Sequence:CCGGTACAGCTGAGTGGGCATCTAGCTCGAGCTAGATGCCCACTCAGCTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007468
APOA4 MISSION shRNA Lentiviral Transduction Particles
apolipoprotein A-IV
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007468.1-548s1c1
Sequence:CCGGCCAACTTAAAGGACAAGTTTACTCGAGTAAACTTGTCCTTTAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007468.1-136s1c1
Sequence:CCGGGAACAGTTTCAGAAGACGGATCTCGAGATCCGTCTTCTGAAACTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007468.1-687s1c1
Sequence:CCGGGCAGGAGAAACTCAACCATCACTCGAGTGATGGTTGAGTTTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007468.1-348s1c1
Sequence:CCGGCAACAAAGTAACCCAGACGTTCTCGAGAACGTCTGGGTTACTTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007468.1-105s1c1
Sequence:CCGGCCAGCTAAGCAACAATGCCAACTCGAGTTGGCATTGTTGCTTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007468.2-396s21c1
Sequence:CCGGATGTGGTGTGGGATTACTTTACTCGAGTAAAGTAATCCCACACCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007468.2-1355s21c1
Sequence:CCGGGAGAAGGTCAACTCCTTTATGCTCGAGCATAAAGGAGTTGACCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007468.2-829s21c1
Sequence:CCGGCAACCTGCACACCTCGATGATCTCGAGATCATCGAGGTGTGCAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007468.2-564s21c1
Sequence:CCGGTACAGCTGAGTGGGCATCTAGCTCGAGCTAGATGCCCACTCAGCTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000482
APOA4 MISSION shRNA Bacterial Glycerol Stock
apolipoprotein A-IV
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000482.2-721s1c1
Sequence:CCGGCCCTACGCTGACGAATTCAAACTCGAGTTTGAATTCGTCAGCGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000482.2-279s1c1
Sequence:CCGGCCAGCAACTCAATGCCCTCTTCTCGAGAAGAGGGCATTGAGTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000482.2-834s1c1
Sequence:CCGGCCTGACCTTCCAGATGAAGAACTCGAGTTCTTCATCTGGAAGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000482.2-730s1c1
Sequence:CCGGGACGAATTCAAAGTCAAGATTCTCGAGAATCTTGACTTTGAATTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000482.2-247s1c1
Sequence:CCGGGCCGTGGAACATCTCCAGAAACTCGAGTTTCTGGAGATGTTCCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000482.3-300s21c1
Sequence:CCGGCTTGGAGAAGTGAACACTTACCTCGAGGTAAGTGTTCACTTCTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000482.3-208s21c1
Sequence:CCGGTCAGCCAGCTGAGCAACAATGCTCGAGCATTGTTGCTCAGCTGGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000482.3-376s21c1
Sequence:CCGGTGGCCAAGGACTCGGAGAAACCTCGAGGTTTCTCCGAGTCCTTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000482
APOA4 MISSION shRNA shRNA Plasmid DNA
apolipoprotein A-IV
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000482.2-721s1c1
Sequence:CCGGCCCTACGCTGACGAATTCAAACTCGAGTTTGAATTCGTCAGCGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000482.2-279s1c1
Sequence:CCGGCCAGCAACTCAATGCCCTCTTCTCGAGAAGAGGGCATTGAGTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000482.2-834s1c1
Sequence:CCGGCCTGACCTTCCAGATGAAGAACTCGAGTTCTTCATCTGGAAGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000482.2-730s1c1
Sequence:CCGGGACGAATTCAAAGTCAAGATTCTCGAGAATCTTGACTTTGAATTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000482.2-247s1c1
Sequence:CCGGGCCGTGGAACATCTCCAGAAACTCGAGTTTCTGGAGATGTTCCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000482.3-300s21c1
Sequence:CCGGCTTGGAGAAGTGAACACTTACCTCGAGGTAAGTGTTCACTTCTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000482.3-208s21c1
Sequence:CCGGTCAGCCAGCTGAGCAACAATGCTCGAGCATTGTTGCTCAGCTGGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000482.3-376s21c1
Sequence:CCGGTGGCCAAGGACTCGGAGAAACCTCGAGGTTTCTCCGAGTCCTTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000482
APOA4 MISSION shRNA Lentiviral Transduction Particles
apolipoprotein A-IV
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000482.2-721s1c1
Sequence:CCGGCCCTACGCTGACGAATTCAAACTCGAGTTTGAATTCGTCAGCGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000482.2-279s1c1
Sequence:CCGGCCAGCAACTCAATGCCCTCTTCTCGAGAAGAGGGCATTGAGTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000482.2-834s1c1
Sequence:CCGGCCTGACCTTCCAGATGAAGAACTCGAGTTCTTCATCTGGAAGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000482.2-730s1c1
Sequence:CCGGGACGAATTCAAAGTCAAGATTCTCGAGAATCTTGACTTTGAATTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000482.2-247s1c1
Sequence:CCGGGCCGTGGAACATCTCCAGAAACTCGAGTTTCTGGAGATGTTCCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000482.3-300s21c1
Sequence:CCGGCTTGGAGAAGTGAACACTTACCTCGAGGTAAGTGTTCACTTCTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000482.3-208s21c1
Sequence:CCGGTCAGCCAGCTGAGCAACAATGCTCGAGCATTGTTGCTCAGCTGGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000482.3-376s21c1
Sequence:CCGGTGGCCAAGGACTCGGAGAAACCTCGAGGTTTCTCCGAGTCCTTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks