EMAIL THIS PAGE TO A FRIEND

APOA5

apolipoprotein A-V

107 Gene Product Result for
Synonyms: APOAV RAP3
UniProtKB ID: Q6Q788, B0YIV9, Q3MIK6, Q6UWK9, Q9UBJ3
Gene ID:
Human(116519) Summary: The protein encoded by this gene is an apolipoprotein that plays an important role in regulating the plasma triglyceride levels, a major risk factor for coronary artery disease. It is a component of high density lipoprotein and is highly similar to a rat protein that is upregulated in response to liver injury. Mutations in this gene have been associated with hypertriglyceridemia and hyperlipoproteinemia type 5. This gene is located proximal to the apolipoprotein gene cluster on chromosome 11q23. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Oct 2009]
Mouse(66113) apolipoprotein A-V
Rat(140638) apolipoprotein A-V
naked mole-rat(101723166) apolipoprotein A-V
domestic guinea pig(100732491) apolipoprotein A-V
sheep(101116760) apolipoprotein A-V
Domestic Rabbit(100328796) apolipoprotein A-V
chicken(419802) apolipoprotein A-V
dog(489393) apolipoprotein A-V
cow(538914) apolipoprotein A-V
domestic cat(101085400) apolipoprotein A-V
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1102590 Anti-APOA5 (351-365) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1102589 Anti-APOA5 (36-50) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1300852 Anti-APOA5 (N-term) antibody produced in rabbit saturated ammonium sulfate (SAS) precipitated, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB2500079 Anti-APOA5 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB1401966 Anti-APOA5 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB3500624 Anti-APOA5 antibody produced in rabbit affinity isolated antibody human, chicken
ELISA, western blot pricing
SAB5300146 Monoclonal Anti-APOA5 antibody produced in mouse clone 4H8H8E2 (c), ascites fluid human
ELISA, western blot pricing
SAB5300147 Monoclonal Anti-APOA5 antibody produced in mouse clone 1G5G9 (c), purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1408851 Monoclonal Anti-APOA5 antibody produced in mouse clone 2C12, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1408852 Monoclonal Anti-APOA5 antibody produced in mouse clone 1H4, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1408853 Monoclonal Anti-APOA5 antibody produced in mouse clone 2B9, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080434 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080434 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080434 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_052968 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052968 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052968 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU017601 MISSION® esiRNA esiRNA targeting mouse Apoa5 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052968 Rosetta Predictions human pricing
NM_080576 Rosetta Predictions rat pricing
NM_080434 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052968 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179768 predicted 1285
2 SASI_Hs01_00179770 predicted 1290
3 SASI_Hs01_00179773 predicted 990
4 SASI_Hs01_00179774 predicted 1391
5 SASI_Hs01_00179775 predicted 1329
6 SASI_Hs02_00361782 predicted 1055
7 SASI_Hs01_00179776 predicted 1169
8 SASI_Hs02_00361783 predicted 398
9 SASI_Hs01_00179777 predicted 1060
10 SASI_Hs02_00361784 predicted 787
11 SASI_Hs01_00179769 predicted 1431
12 SASI_Hs01_00179771 predicted 405
13 SASI_Hs01_00179772 predicted 401
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080576 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093879 predicted 1425
2 SASI_Rn01_00093880 predicted 1377
3 SASI_Rn01_00093881 predicted 1256
4 SASI_Rn01_00093883 predicted 631
5 SASI_Rn01_00093884 predicted 1383
6 SASI_Rn01_00093885 predicted 1446
7 SASI_Rn01_00093886 predicted 1426
8 SASI_Rn01_00093887 predicted 1537
9 SASI_Rn01_00093888 predicted 1108
10 SASI_Rn02_00267239 predicted 1582
11 SASI_Rn01_00093882 predicted 702
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080434 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158179 predicted 1296
2 SASI_Mm01_00158180 predicted 1137
3 SASI_Mm01_00158181 predicted 637
4 SASI_Mm01_00158182 predicted 402
5 SASI_Mm02_00338087 predicted 578
6 SASI_Mm01_00158184 predicted 1406
7 SASI_Mm01_00158185 predicted 1123
8 SASI_Mm01_00158186 predicted 997
9 SASI_Mm01_00158187 predicted 1038
10 SASI_Mm01_00158188 predicted 1389
11 SASI_Mm01_00158183 predicted 684
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080434
APOA5 MISSION shRNA Bacterial Glycerol Stock
apolipoprotein A-V
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438201    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080434.3-1422s21c1
Sequence:CCGGGGAGTTGGGCTCCTGTTAATTCTCGAGAATTAACAGGAGCCCAACTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080434.3-1054s21c1
Sequence:CCGGACGACCTGTGGGAAGATATTGCTCGAGCAATATCTTCCCACAGGTCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105300    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080434.2-2021s1c1
Sequence:CCGGGCTGTCTTGTTCCACAGTCTACTCGAGTAGACTGTGGAACAAGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080434.2-601s1c1
Sequence:CCGGGAACGCTTGGTGACTGGAATTCTCGAGAATTCCAGTCACCAAGCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080434.2-708s1c1
Sequence:CCGGGTCCCACAAACTCACACGTAACTCGAGTTACGTGTGAGTTTGTGGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080434.2-910s1c1
Sequence:CCGGGCTGCATTTACTCAGGCCATTCTCGAGAATGGCCTGAGTAAATGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080434.2-196s1c1
Sequence:CCGGGACCTCTACAATATGAACAATCTCGAGATTGTTCATATTGTAGAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080434
APOA5 MISSION shRNA shRNA Plasmid DNA
apolipoprotein A-V
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438201    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080434.3-1422s21c1
Sequence:CCGGGGAGTTGGGCTCCTGTTAATTCTCGAGAATTAACAGGAGCCCAACTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080434.3-1054s21c1
Sequence:CCGGACGACCTGTGGGAAGATATTGCTCGAGCAATATCTTCCCACAGGTCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105300    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080434.2-2021s1c1
Sequence:CCGGGCTGTCTTGTTCCACAGTCTACTCGAGTAGACTGTGGAACAAGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080434.2-601s1c1
Sequence:CCGGGAACGCTTGGTGACTGGAATTCTCGAGAATTCCAGTCACCAAGCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080434.2-708s1c1
Sequence:CCGGGTCCCACAAACTCACACGTAACTCGAGTTACGTGTGAGTTTGTGGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080434.2-910s1c1
Sequence:CCGGGCTGCATTTACTCAGGCCATTCTCGAGAATGGCCTGAGTAAATGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080434.2-196s1c1
Sequence:CCGGGACCTCTACAATATGAACAATCTCGAGATTGTTCATATTGTAGAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080434
APOA5 MISSION shRNA Lentiviral Transduction Particles
apolipoprotein A-V
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438201    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080434.3-1422s21c1
Sequence:CCGGGGAGTTGGGCTCCTGTTAATTCTCGAGAATTAACAGGAGCCCAACTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080434.3-1054s21c1
Sequence:CCGGACGACCTGTGGGAAGATATTGCTCGAGCAATATCTTCCCACAGGTCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105300    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080434.2-2021s1c1
Sequence:CCGGGCTGTCTTGTTCCACAGTCTACTCGAGTAGACTGTGGAACAAGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080434.2-601s1c1
Sequence:CCGGGAACGCTTGGTGACTGGAATTCTCGAGAATTCCAGTCACCAAGCGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080434.2-708s1c1
Sequence:CCGGGTCCCACAAACTCACACGTAACTCGAGTTACGTGTGAGTTTGTGGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080434.2-910s1c1
Sequence:CCGGGCTGCATTTACTCAGGCCATTCTCGAGAATGGCCTGAGTAAATGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080434.2-196s1c1
Sequence:CCGGGACCTCTACAATATGAACAATCTCGAGATTGTTCATATTGTAGAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052968
APOA5 MISSION shRNA Bacterial Glycerol Stock
apolipoprotein A-V
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052968.3-1402s21c1
Sequence:CCGGCCATGCATGTGGGTGATTATCCTCGAGGATAATCACCCACATGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052968.3-877s21c1
Sequence:CCGGAGGACACCTACCTGCAGATAGCTCGAGCTATCTGCAGGTAGGTGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052968.3-1289s21c1
Sequence:CCGGCAATCTGGATGCATTACATTCCTCGAGGAATGTAATGCATCCAGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052968.2-191s1c1
Sequence:CCGGGCAAGACCTCAACAATATGAACTCGAGTTCATATTGTTGAGGTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052968.2-398s1c1
Sequence:CCGGGCCCTACACGATGGATCTGATCTCGAGATCAGATCCATCGTGTAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052968.2-1056s1c1
Sequence:CCGGGACATCACTCACAGCCTTCATCTCGAGATGAAGGCTGTGAGTGATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052968.2-80s1c1
Sequence:CCGGGAAAGGCTTCTGGGACTACTTCTCGAGAAGTAGTCCCAGAAGCCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052968.2-197s1c1
Sequence:CCGGCCTCAACAATATGAACAAGTTCTCGAGAACTTGTTCATATTGTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052968
APOA5 MISSION shRNA shRNA Plasmid DNA
apolipoprotein A-V
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052968.3-1402s21c1
Sequence:CCGGCCATGCATGTGGGTGATTATCCTCGAGGATAATCACCCACATGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052968.3-877s21c1
Sequence:CCGGAGGACACCTACCTGCAGATAGCTCGAGCTATCTGCAGGTAGGTGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052968.3-1289s21c1
Sequence:CCGGCAATCTGGATGCATTACATTCCTCGAGGAATGTAATGCATCCAGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052968.2-191s1c1
Sequence:CCGGGCAAGACCTCAACAATATGAACTCGAGTTCATATTGTTGAGGTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052968.2-398s1c1
Sequence:CCGGGCCCTACACGATGGATCTGATCTCGAGATCAGATCCATCGTGTAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052968.2-1056s1c1
Sequence:CCGGGACATCACTCACAGCCTTCATCTCGAGATGAAGGCTGTGAGTGATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052968.2-80s1c1
Sequence:CCGGGAAAGGCTTCTGGGACTACTTCTCGAGAAGTAGTCCCAGAAGCCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052968.2-197s1c1
Sequence:CCGGCCTCAACAATATGAACAAGTTCTCGAGAACTTGTTCATATTGTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052968
APOA5 MISSION shRNA Lentiviral Transduction Particles
apolipoprotein A-V
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052968.3-1402s21c1
Sequence:CCGGCCATGCATGTGGGTGATTATCCTCGAGGATAATCACCCACATGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052968.3-877s21c1
Sequence:CCGGAGGACACCTACCTGCAGATAGCTCGAGCTATCTGCAGGTAGGTGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052968.3-1289s21c1
Sequence:CCGGCAATCTGGATGCATTACATTCCTCGAGGAATGTAATGCATCCAGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052968.2-191s1c1
Sequence:CCGGGCAAGACCTCAACAATATGAACTCGAGTTCATATTGTTGAGGTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052968.2-398s1c1
Sequence:CCGGGCCCTACACGATGGATCTGATCTCGAGATCAGATCCATCGTGTAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052968.2-1056s1c1
Sequence:CCGGGACATCACTCACAGCCTTCATCTCGAGATGAAGGCTGTGAGTGATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052968.2-80s1c1
Sequence:CCGGGAAAGGCTTCTGGGACTACTTCTCGAGAAGTAGTCCCAGAAGCCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052968.2-197s1c1
Sequence:CCGGCCTCAACAATATGAACAAGTTCTCGAGAACTTGTTCATATTGTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)