EMAIL THIS PAGE TO A FRIEND

APOB

apolipoprotein B

110 Gene Product Result for
Synonyms: FLDB LDLCQ4
Gene ID:
Human(338) Summary: This gene product is the main apolipoprotein of chylomicrons and low density lipoproteins. It occurs in plasma as two main isoforms, apoB-48 and apoB-100: the former is synthesized exclusively in the gut and the latter in the liver. The intestinal and the hepatic forms of apoB are encoded by a single gene from a single, very long mRNA. The two isoforms share a common N-terminal sequence. The shorter apoB-48 protein is produced after RNA editing of the apoB-100 transcript at residue 2180 (CAA->UAA), resulting in the creation of a stop codon, and early translation termination. Mutations in this gene or its regulatory region cause hypobetalipoproteinemia, normotriglyceridemic hypobetalipoproteinemia, and hypercholesterolemia due to ligand-defective apoB, diseases affecting plasma cholesterol and apoB levels. [provided by RefSeq, Jul 2008]
Mouse(238055) apolipoprotein B
Rat(54225) apolipoprotein B
chicken(396535) apolipoprotein B (including Ag(x) antigen)
cow(494004) apolipoprotein B
domestic cat(101098863) apolipoprotein B (including Ag(x) antigen)
Horse(100071824) apolipoprotein B (including Ag(x) antigen)
dog(475680) apolipoprotein B (including Ag(x) antigen)
sheep(101107590) apolipoprotein B (including Ag(x) antigen)
Domestic Rabbit(100009101) apolipoprotein B (including Ag(x) antigen)
naked mole-rat(101703081) apolipoprotein B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000384 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000384 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000384 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009693 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009693 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009693 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000384 Rosetta Predictions human pricing
NM_019287 Rosetta Predictions rat pricing
NM_009693 Rosetta Predictions mouse pricing
XM_137955 Rosetta Predictions mouse pricing
XM_894981 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000384 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214488 predicted 5487
2 SASI_Hs01_00214490 predicted 3346
3 SASI_Hs01_00214492 predicted 8619
4 SASI_Hs02_00302452 predicted 11656
5 SASI_Hs01_00214493 predicted 4625
6 SASI_Hs01_00214494 predicted 7588
7 SASI_Hs02_00302453 predicted 7627
8 SASI_Hs01_00214495 predicted 5268
9 SASI_Hs01_00214496 predicted 8258
10 SASI_Hs02_00302454 predicted 7464
11 SASI_Hs01_00214489 predicted 12640
12 SASI_Hs01_00214491 predicted 12458
13 SASI_Hs01_00214497 predicted 8111
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019287 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062894 predicted 12334
2 SASI_Rn01_00062896 predicted 3340
3 SASI_Rn02_00262226 predicted 8609
4 SASI_Rn01_00062897 predicted 10699
5 SASI_Rn02_00262227 predicted 13498
6 SASI_Rn02_00262228 predicted 3170
7 SASI_Rn01_00062899 predicted 12583
8 SASI_Rn01_00062900 predicted 3777
9 SASI_Rn02_00262229 predicted 9507
10 SASI_Rn01_00062902 predicted 9358
11 SASI_Rn01_00062895 predicted 12298
12 SASI_Rn01_00062898 predicted 12290
13 SASI_Rn01_00062901 predicted 6957
14 SASI_Rn01_00062903 predicted 11261
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009693 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316799 predicted 6551
2 SASI_Mm02_00316800 predicted 322
3 SASI_Mm02_00316801 predicted 11863
4 SASI_Mm02_00316802 predicted 2664
5 SASI_Mm02_00316803 predicted 3231
6 SASI_Mm02_00316804 predicted 13480
7 SASI_Mm02_00316805 predicted 1520
8 SASI_Mm02_00316806 predicted 12974
9 SASI_Mm02_00316807 predicted 9327
10 SASI_Mm02_00316808 predicted 538
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_137955 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00220109 predicted 356
2 SASI_Mm01_00220110 predicted 11901
3 SASI_Mm01_00220111 predicted 2699
4 SASI_Mm01_00220112 predicted 3263
5 SASI_Mm01_00220113 predicted 13506
6 SASI_Mm01_00220114 predicted 13009
7 SASI_Mm01_00220115 predicted 9365
8 SASI_Mm01_00220116 predicted 9622
9 SASI_Mm01_00220117 predicted 577
10 SASI_Mm01_00220118 predicted 12677
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_894981 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00203002 predicted 11668
2 SASI_Mm01_00203003 predicted 2536
3 SASI_Mm01_00203004 predicted 3095
4 SASI_Mm01_00203005 predicted 13286
5 SASI_Mm01_00203006 predicted 12775
6 SASI_Mm01_00203007 predicted 9134
7 SASI_Mm01_00203008 predicted 9398
8 SASI_Mm01_00203009 predicted 411
9 SASI_Mm01_00203010 predicted 12439
10 SASI_Mm01_00203011 predicted 6499
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000384
APOB MISSION shRNA Bacterial Glycerol Stock
apolipoprotein B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000384.x-1469s1c1
Sequence:CCGGCGCGGTCAACAACTATCATAACTCGAGTTATGATAGTTGTTGACCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003739    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000384.x-14011s1c1
Sequence:CCGGGAACTCAGAAGGATGGCATTTCTCGAGAAATGCCATCCTTCTGAGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000384.x-2031s1c1
Sequence:CCGGCGGAACTATCAACTCTACAAACTCGAGTTTGTAGAGTTGATAGTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000384.x-12093s1c1
Sequence:CCGGCGCTACCAGAAAGACAAGAAACTCGAGTTTCTTGTCTTTCTGGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000384.x-9438s1c1
Sequence:CCGGGCTGGAAACAACGAGAACATTCTCGAGAATGTTCTCGTTGTTTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000384
APOB MISSION shRNA shRNA Plasmid DNA
apolipoprotein B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000384.x-1469s1c1
Sequence:CCGGCGCGGTCAACAACTATCATAACTCGAGTTATGATAGTTGTTGACCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003739    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000384.x-14011s1c1
Sequence:CCGGGAACTCAGAAGGATGGCATTTCTCGAGAAATGCCATCCTTCTGAGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000384.x-2031s1c1
Sequence:CCGGCGGAACTATCAACTCTACAAACTCGAGTTTGTAGAGTTGATAGTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000384.x-12093s1c1
Sequence:CCGGCGCTACCAGAAAGACAAGAAACTCGAGTTTCTTGTCTTTCTGGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000384.x-9438s1c1
Sequence:CCGGGCTGGAAACAACGAGAACATTCTCGAGAATGTTCTCGTTGTTTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000384
APOB MISSION shRNA Lentiviral Transduction Particles
apolipoprotein B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000384.x-1469s1c1
Sequence:CCGGCGCGGTCAACAACTATCATAACTCGAGTTATGATAGTTGTTGACCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003739    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000384.x-14011s1c1
Sequence:CCGGGAACTCAGAAGGATGGCATTTCTCGAGAAATGCCATCCTTCTGAGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000384.x-2031s1c1
Sequence:CCGGCGGAACTATCAACTCTACAAACTCGAGTTTGTAGAGTTGATAGTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000384.x-12093s1c1
Sequence:CCGGCGCTACCAGAAAGACAAGAAACTCGAGTTTCTTGTCTTTCTGGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000384.x-9438s1c1
Sequence:CCGGGCTGGAAACAACGAGAACATTCTCGAGAATGTTCTCGTTGTTTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009693
VALIDATED
APOB MISSION shRNA Bacterial Glycerol Stock
apolipoprotein B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009693.2-7636s21c1
Sequence:CCGGGATGTAAGAGACCGAATTTATCTCGAGATAAATTCGGTCTCTTACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009693.2-13278s21c1
Sequence:CCGGTAGCATGCTTACTGATATAAACTCGAGTTTATATCAGTAAGCATGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009693.2-4370s21c1
Sequence:CCGGATGGATCTCTACACCATAAATCTCGAGATTTATGGTGTAGAGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009693.2-11809s21c1
Sequence:CCGGGAAGATCTGTTAACCTATAATCTCGAGATTATAGGTTAACAGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253386    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009693.2-13664s21c1
Sequence:CCGGGACTTTGTAGACTACTATAAACTCGAGTTTATAGTAGTCTACAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009693
VALIDATED
APOB MISSION shRNA shRNA Plasmid DNA
apolipoprotein B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009693.2-7636s21c1
Sequence:CCGGGATGTAAGAGACCGAATTTATCTCGAGATAAATTCGGTCTCTTACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009693.2-13278s21c1
Sequence:CCGGTAGCATGCTTACTGATATAAACTCGAGTTTATATCAGTAAGCATGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009693.2-4370s21c1
Sequence:CCGGATGGATCTCTACACCATAAATCTCGAGATTTATGGTGTAGAGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009693.2-11809s21c1
Sequence:CCGGGAAGATCTGTTAACCTATAATCTCGAGATTATAGGTTAACAGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253386    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009693.2-13664s21c1
Sequence:CCGGGACTTTGTAGACTACTATAAACTCGAGTTTATAGTAGTCTACAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009693
VALIDATED
APOB MISSION shRNA Lentiviral Transduction Particles
apolipoprotein B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009693.2-7636s21c1
Sequence:CCGGGATGTAAGAGACCGAATTTATCTCGAGATAAATTCGGTCTCTTACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009693.2-13278s21c1
Sequence:CCGGTAGCATGCTTACTGATATAAACTCGAGTTTATATCAGTAAGCATGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009693.2-4370s21c1
Sequence:CCGGATGGATCTCTACACCATAAATCTCGAGATTTATGGTGTAGAGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009693.2-11809s21c1
Sequence:CCGGGAAGATCTGTTAACCTATAATCTCGAGATTATAGGTTAACAGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253386    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009693.2-13664s21c1
Sequence:CCGGGACTTTGTAGACTACTATAAACTCGAGTTTATAGTAGTCTACAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks