EMAIL THIS PAGE TO A FRIEND

APOBEC1

apolipoprotein B mRNA editing enzyme, catalytic polypeptide 1

57 Gene Product Result for
Synonyms: APOBEC-1 BEDP CDAR1 HEPR
UniProtKB ID: P41238, Q9UE64, Q9UM71
Gene ID:
Human(339) Summary: This gene encodes a member of the cytidine deaminase enzyme family. The encoded protein forms a multiple-protein editing holoenzyme with APOBEC1 complementation factor (ACF) and APOBEC1 stimulating protein (ASP). This holoenzyme is involved in the editing of C-to-U nucleotide bases in apolipoprotein B and neurofibromatosis-1 mRNAs. [provided by RefSeq, Jul 2008]
Mouse(11810) apolipoprotein B mRNA editing enzyme, catalytic polypeptide 1
Rat(25383) apolipoprotein B mRNA editing enzyme, catalytic polypeptide 1
dog(486699) apolipoprotein B mRNA editing enzyme, catalytic polypeptide 1
cow(516043) apolipoprotein B mRNA editing enzyme, catalytic polypeptide 1
Horse(100061100) apolipoprotein B mRNA editing enzyme, catalytic polypeptide 1
domestic cat(101100896) apolipoprotein B mRNA editing enzyme, catalytic polypeptide 1
sheep(101105238) apolipoprotein B mRNA editing enzyme, catalytic polypeptide 1
Domestic Rabbit(100009191) apolipoprotein B mRNA editing enzyme, catalytic polypeptide 1
naked mole-rat(101708425) apolipoprotein B mRNA editing enzyme, catalytic polypeptide 1
domestic guinea pig(100734070) apolipoprotein B mRNA editing enzyme, catalytic polypeptide 1
Gene Class: Amidase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1300050 Anti-Apobec1 (N-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB2500081 Anti-APOBEC1 antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, human
ELISA, western blot pricing
SAB2100132 Anti-APOBEC1 antibody produced in rabbit affinity isolated antibody human, rabbit, rat, mouse, horse, rabbit
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001644 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001644 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001644 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031159 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031159 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031159 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001644 Rosetta Predictions human pricing
NM_012907 Rosetta Predictions rat pricing
NM_031159 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001644 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332236 predicted 594
2 SASI_Hs01_00144849 predicted 574
3 SASI_Hs01_00144850 predicted 593
4 SASI_Hs01_00144851 predicted 568
5 SASI_Hs01_00144852 predicted 460
6 SASI_Hs01_00144853 predicted 579
7 SASI_Hs01_00144854 predicted 568
8 SASI_Hs01_00144855 predicted 571
9 SASI_Hs01_00144856 predicted 598
10 SASI_Hs01_00144857 predicted 598
11 SASI_Hs01_00144858 predicted 464
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012907 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059206 predicted 1029
2 SASI_Rn02_00260442 predicted 1011
3 SASI_Rn01_00059208 predicted 1025
4 SASI_Rn01_00059209 predicted 900
5 SASI_Rn01_00059210 predicted 1026
6 SASI_Rn01_00059211 predicted 976
7 SASI_Rn01_00059212 predicted 627
8 SASI_Rn01_00059214 predicted 935
9 SASI_Rn01_00059215 predicted 839
10 SASI_Rn02_00260443 predicted 659
11 SASI_Rn01_00059207 predicted 936
12 SASI_Rn01_00059213 predicted 731
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031159 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190504 predicted 908
2 SASI_Mm01_00190505 predicted 1364
3 SASI_Mm01_00190506 predicted 1301
4 SASI_Mm01_00190507 predicted 852
5 SASI_Mm01_00190509 predicted 1351
6 SASI_Mm01_00190511 predicted 1272
7 SASI_Mm01_00190512 predicted 966
8 SASI_Mm02_00336970 predicted 738
9 SASI_Mm02_00336971 predicted 973
10 SASI_Mm02_00336972 predicted 1237
11 SASI_Mm01_00190508 predicted 956
12 SASI_Mm01_00190510 predicted 1100
13 SASI_Mm01_00190513 predicted 1408
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001644
APOBEC1 MISSION shRNA Bacterial Glycerol Stock
apolipoprotein B mRNA editing enzyme, catalytic polypeptide 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001644.3-422s21c1
Sequence:CCGGGGTCTCAGGGACCTTGTTAACCTCGAGGTTAACAAGGTCCCTGAGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001644.3-669s21c1
Sequence:CCGGACTGCCATTACCAAACGATTCCTCGAGGAATCGTTTGGTAATGGCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001644.2-325s1c1
Sequence:CCGGCCAGGCTATTAGAGAGTTTCTCTCGAGAGAAACTCTCTAATAGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001644.2-572s1c1
Sequence:CCGGCTGGAGCTGCACTGCATAATTCTCGAGAATTATGCAGTGCAGCTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001644.2-207s1c1
Sequence:CCGGCCACCAATCACGTGGAAGTTACTCGAGTAACTTCCACGTGATTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001644.2-95s1c1
Sequence:CCGGTGGGAGTTTGACGTCTTCTATCTCGAGATAGAAGACGTCAAACTCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001644.2-444s1c1
Sequence:CCGGGTGGAGTAACTATTCAGATTACTCGAGTAATCTGAATAGTTACTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001644
APOBEC1 MISSION shRNA shRNA Plasmid DNA
apolipoprotein B mRNA editing enzyme, catalytic polypeptide 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001644.3-422s21c1
Sequence:CCGGGGTCTCAGGGACCTTGTTAACCTCGAGGTTAACAAGGTCCCTGAGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001644.3-669s21c1
Sequence:CCGGACTGCCATTACCAAACGATTCCTCGAGGAATCGTTTGGTAATGGCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001644.2-325s1c1
Sequence:CCGGCCAGGCTATTAGAGAGTTTCTCTCGAGAGAAACTCTCTAATAGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001644.2-572s1c1
Sequence:CCGGCTGGAGCTGCACTGCATAATTCTCGAGAATTATGCAGTGCAGCTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001644.2-207s1c1
Sequence:CCGGCCACCAATCACGTGGAAGTTACTCGAGTAACTTCCACGTGATTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001644.2-95s1c1
Sequence:CCGGTGGGAGTTTGACGTCTTCTATCTCGAGATAGAAGACGTCAAACTCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001644.2-444s1c1
Sequence:CCGGGTGGAGTAACTATTCAGATTACTCGAGTAATCTGAATAGTTACTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001644
APOBEC1 MISSION shRNA Lentiviral Transduction Particles
apolipoprotein B mRNA editing enzyme, catalytic polypeptide 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001644.3-422s21c1
Sequence:CCGGGGTCTCAGGGACCTTGTTAACCTCGAGGTTAACAAGGTCCCTGAGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001644.3-669s21c1
Sequence:CCGGACTGCCATTACCAAACGATTCCTCGAGGAATCGTTTGGTAATGGCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001644.2-325s1c1
Sequence:CCGGCCAGGCTATTAGAGAGTTTCTCTCGAGAGAAACTCTCTAATAGCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001644.2-572s1c1
Sequence:CCGGCTGGAGCTGCACTGCATAATTCTCGAGAATTATGCAGTGCAGCTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001644.2-207s1c1
Sequence:CCGGCCACCAATCACGTGGAAGTTACTCGAGTAACTTCCACGTGATTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001644.2-95s1c1
Sequence:CCGGTGGGAGTTTGACGTCTTCTATCTCGAGATAGAAGACGTCAAACTCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001644.2-444s1c1
Sequence:CCGGGTGGAGTAACTATTCAGATTACTCGAGTAATCTGAATAGTTACTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031159
VALIDATED
APOBEC1 MISSION shRNA Bacterial Glycerol Stock
apolipoprotein B mRNA editing enzyme, catalytic polypeptide 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000316592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031159.3-620s21c1
Sequence:CCGGCCACGAGTTTGAAGTCTTCTTCTCGAGAAGAAGACTTCAAACTCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031159.3-742s21c1
Sequence:CCGGACGTTGAAGTCAACTTCTTAGCTCGAGCTAAGAAGTTGACTTCAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031159.3-945s21c1
Sequence:CCGGCAAGGACTCAGGGACCTTATTCTCGAGAATAAGGTCCCTGAGTCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031159.3-1119s21c1
Sequence:CCGGTTAGGACTTCCACCCTGTTTACTCGAGTAAACAGGGTGGAAGTCCTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031159.3-1405s21c1
Sequence:CCGGCCTTGGTTTAATTCCAAGAATCTCGAGATTCTTGGAATTAAACCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098680    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031159.2-1405s1c1
Sequence:CCGGCCTTGGTTTAATTCCAAGAATCTCGAGATTCTTGGAATTAAACCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031159.2-971s1c1
Sequence:CCGGCGGTGTGACTATCCAGATCATCTCGAGATGATCTGGATAGTCACACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031159.2-912s1c1
Sequence:CCGGCGGCTTTATCACCACACGGATCTCGAGATCCGTGTGGTGATAAAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031159.2-620s1c1
Sequence:CCGGCCACGAGTTTGAAGTCTTCTTCTCGAGAAGAAGACTTCAAACTCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031159
VALIDATED
APOBEC1 MISSION shRNA shRNA Plasmid DNA
apolipoprotein B mRNA editing enzyme, catalytic polypeptide 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000316592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031159.3-620s21c1
Sequence:CCGGCCACGAGTTTGAAGTCTTCTTCTCGAGAAGAAGACTTCAAACTCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031159.3-742s21c1
Sequence:CCGGACGTTGAAGTCAACTTCTTAGCTCGAGCTAAGAAGTTGACTTCAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031159.3-945s21c1
Sequence:CCGGCAAGGACTCAGGGACCTTATTCTCGAGAATAAGGTCCCTGAGTCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031159.3-1119s21c1
Sequence:CCGGTTAGGACTTCCACCCTGTTTACTCGAGTAAACAGGGTGGAAGTCCTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031159.3-1405s21c1
Sequence:CCGGCCTTGGTTTAATTCCAAGAATCTCGAGATTCTTGGAATTAAACCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098680    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031159.2-1405s1c1
Sequence:CCGGCCTTGGTTTAATTCCAAGAATCTCGAGATTCTTGGAATTAAACCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031159.2-971s1c1
Sequence:CCGGCGGTGTGACTATCCAGATCATCTCGAGATGATCTGGATAGTCACACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031159.2-912s1c1
Sequence:CCGGCGGCTTTATCACCACACGGATCTCGAGATCCGTGTGGTGATAAAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031159.2-620s1c1
Sequence:CCGGCCACGAGTTTGAAGTCTTCTTCTCGAGAAGAAGACTTCAAACTCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031159
VALIDATED
APOBEC1 MISSION shRNA Lentiviral Transduction Particles
apolipoprotein B mRNA editing enzyme, catalytic polypeptide 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000316592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031159.3-620s21c1
Sequence:CCGGCCACGAGTTTGAAGTCTTCTTCTCGAGAAGAAGACTTCAAACTCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031159.3-742s21c1
Sequence:CCGGACGTTGAAGTCAACTTCTTAGCTCGAGCTAAGAAGTTGACTTCAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031159.3-945s21c1
Sequence:CCGGCAAGGACTCAGGGACCTTATTCTCGAGAATAAGGTCCCTGAGTCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031159.3-1119s21c1
Sequence:CCGGTTAGGACTTCCACCCTGTTTACTCGAGTAAACAGGGTGGAAGTCCTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031159.3-1405s21c1
Sequence:CCGGCCTTGGTTTAATTCCAAGAATCTCGAGATTCTTGGAATTAAACCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098680    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031159.2-1405s1c1
Sequence:CCGGCCTTGGTTTAATTCCAAGAATCTCGAGATTCTTGGAATTAAACCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031159.2-971s1c1
Sequence:CCGGCGGTGTGACTATCCAGATCATCTCGAGATGATCTGGATAGTCACACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031159.2-912s1c1
Sequence:CCGGCGGCTTTATCACCACACGGATCTCGAGATCCGTGTGGTGATAAAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031159.2-620s1c1
Sequence:CCGGCCACGAGTTTGAAGTCTTCTTCTCGAGAAGAAGACTTCAAACTCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)