EMAIL THIS PAGE TO A FRIEND

APOBEC2

apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 2

51 Gene Product Result for
Synonyms: ARCD1 ARP1
UniProtKB ID: Q9Y235, B2R899, Q53F28, Q5TGU5, Q5TGU6
Gene ID:
Mouse(11811) apolipoprotein B mRNA editing enzyme, catalytic polypeptide 2
Rat(301226) apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 2
domestic guinea pig(100718786) apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 2
naked mole-rat(101720974) apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 2
sheep(101103930) apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 2
chicken(419915) apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 2
dog(481788) apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 2
cow(509619) apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 2
domestic cat(101098384) apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006789 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006789 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006789 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009694 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009694 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009694 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006789 Rosetta Predictions human pricing
NM_001106883 Rosetta Predictions rat pricing
NM_009694 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006789 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161085 predicted 282
2 SASI_Hs01_00161086 predicted 575
3 SASI_Hs02_00342308 predicted 812
4 SASI_Hs01_00161087 predicted 891
5 SASI_Hs01_00161088 predicted 656
6 SASI_Hs01_00161090 predicted 911
7 SASI_Hs01_00161091 predicted 587
8 SASI_Hs01_00161092 predicted 819
9 SASI_Hs01_00161093 predicted 800
10 SASI_Hs01_00161094 predicted 363
11 SASI_Hs01_00161089 predicted 885
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106883 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223346 predicted 935
2 SASI_Rn02_00223347 predicted 936
3 SASI_Rn02_00223348 predicted 778
4 SASI_Rn02_00223349 predicted 261
5 SASI_Rn02_00223350 predicted 636
6 SASI_Rn02_00223351 predicted 624
7 SASI_Rn02_00223352 predicted 721
8 SASI_Rn02_00223353 predicted 871
9 SASI_Rn02_00223354 predicted 447
10 SASI_Rn02_00223355 predicted 869
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009694 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092402 predicted 777
2 SASI_Mm01_00092403 predicted 697
3 SASI_Mm01_00092404 predicted 794
4 SASI_Mm01_00092405 predicted 328
5 SASI_Mm01_00092407 predicted 631
6 SASI_Mm01_00092408 predicted 618
7 SASI_Mm01_00092409 predicted 864
8 SASI_Mm01_00092410 predicted 980
9 SASI_Mm01_00092411 predicted 442
10 SASI_Mm02_00316809 predicted 310
11 SASI_Mm01_00092406 predicted 880
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006789
APOBEC2 MISSION shRNA Bacterial Glycerol Stock
apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006789.2-626s1c1
Sequence:CCGGCGAATATGTCTGGCAGAATTTCTCGAGAAATTCTGCCAGACATATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006789.2-215s1c1
Sequence:CCGGGCCTGCCAACTTCTTTAAATTCTCGAGAATTTAAAGAAGTTGGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006789.2-420s1c1
Sequence:CCGGCGGTACAATGTCACCTGGTATCTCGAGATACCAGGTGACATTGTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006789.2-263s1c1
Sequence:CCGGCGGGAGGAACAAGACCTTCCTCTCGAGAGGAAGGTCTTGTTCCTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006789.2-707s1c1
Sequence:CCGGCTTCCTATACTACGAGGAGAACTCGAGTTCTCCTCGTAGTATAGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006789.3-534s21c1
Sequence:CCGGAGCGTGTGCTGACCGCATTATCTCGAGATAATGCGGTCAGCACACGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006789.3-916s21c1
Sequence:CCGGATTTGGAGCTGGACAACATTTCTCGAGAAATGTTGTCCAGCTCCAAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006789.3-1100s21c1
Sequence:CCGGATGGGACTGAAGGTCCTAATTCTCGAGAATTAGGACCTTCAGTCCCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006789
APOBEC2 MISSION shRNA shRNA Plasmid DNA
apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006789.2-626s1c1
Sequence:CCGGCGAATATGTCTGGCAGAATTTCTCGAGAAATTCTGCCAGACATATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006789.2-215s1c1
Sequence:CCGGGCCTGCCAACTTCTTTAAATTCTCGAGAATTTAAAGAAGTTGGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006789.2-420s1c1
Sequence:CCGGCGGTACAATGTCACCTGGTATCTCGAGATACCAGGTGACATTGTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006789.2-263s1c1
Sequence:CCGGCGGGAGGAACAAGACCTTCCTCTCGAGAGGAAGGTCTTGTTCCTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006789.2-707s1c1
Sequence:CCGGCTTCCTATACTACGAGGAGAACTCGAGTTCTCCTCGTAGTATAGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006789.3-534s21c1
Sequence:CCGGAGCGTGTGCTGACCGCATTATCTCGAGATAATGCGGTCAGCACACGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006789.3-916s21c1
Sequence:CCGGATTTGGAGCTGGACAACATTTCTCGAGAAATGTTGTCCAGCTCCAAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006789.3-1100s21c1
Sequence:CCGGATGGGACTGAAGGTCCTAATTCTCGAGAATTAGGACCTTCAGTCCCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006789
APOBEC2 MISSION shRNA Lentiviral Transduction Particles
apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006789.2-626s1c1
Sequence:CCGGCGAATATGTCTGGCAGAATTTCTCGAGAAATTCTGCCAGACATATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006789.2-215s1c1
Sequence:CCGGGCCTGCCAACTTCTTTAAATTCTCGAGAATTTAAAGAAGTTGGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006789.2-420s1c1
Sequence:CCGGCGGTACAATGTCACCTGGTATCTCGAGATACCAGGTGACATTGTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006789.2-263s1c1
Sequence:CCGGCGGGAGGAACAAGACCTTCCTCTCGAGAGGAAGGTCTTGTTCCTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006789.2-707s1c1
Sequence:CCGGCTTCCTATACTACGAGGAGAACTCGAGTTCTCCTCGTAGTATAGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006789.3-534s21c1
Sequence:CCGGAGCGTGTGCTGACCGCATTATCTCGAGATAATGCGGTCAGCACACGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006789.3-916s21c1
Sequence:CCGGATTTGGAGCTGGACAACATTTCTCGAGAAATGTTGTCCAGCTCCAAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006789.3-1100s21c1
Sequence:CCGGATGGGACTGAAGGTCCTAATTCTCGAGAATTAGGACCTTCAGTCCCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009694
APOBEC2 MISSION shRNA Bacterial Glycerol Stock
apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009694.1-868s1c1
Sequence:CCGGCCTGGCTTCCTGATTCTACTTCTCGAGAAGTAGAATCAGGAAGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009694.1-160s1c1
Sequence:CCGGGCCTCTCAGAATGGAGATGATCTCGAGATCATCTCCATTCTGAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009694.1-258s1c1
Sequence:CCGGGCTACCAGTCAACTTCTTCAACTCGAGTTGAAGAAGTTGACTGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009694.1-753s1c1
Sequence:CCGGCTTCCTATACTATGAGGAGAACTCGAGTTCTCCTCATAGTATAGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009694.3-336s21c1
Sequence:CCGGGTGGTCGAAGTACAGAGTAAGCTCGAGCTTACTCTGTACTTCGACCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009694.3-309s21c1
Sequence:CCGGGGGCGGAATAAGACCTTTCTCCTCGAGGAGAAAGGTCTTATTCCGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009694.3-282s21c1
Sequence:CCGGCAGTTCCGGAACGTGGAATACCTCGAGGTATTCCACGTTCCGGAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009694.3-510s21c1
Sequence:CCGGTGCGCTGACCGGATTCTCAAACTCGAGTTTGAGAATCCGGTCAGCGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009694.3-223s21c1
Sequence:CCGGATCTTCCGCCCTTCGAGATTGCTCGAGCAATCTCGAAGGGCGGAAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009694
APOBEC2 MISSION shRNA shRNA Plasmid DNA
apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009694.1-868s1c1
Sequence:CCGGCCTGGCTTCCTGATTCTACTTCTCGAGAAGTAGAATCAGGAAGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009694.1-160s1c1
Sequence:CCGGGCCTCTCAGAATGGAGATGATCTCGAGATCATCTCCATTCTGAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009694.1-258s1c1
Sequence:CCGGGCTACCAGTCAACTTCTTCAACTCGAGTTGAAGAAGTTGACTGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009694.1-753s1c1
Sequence:CCGGCTTCCTATACTATGAGGAGAACTCGAGTTCTCCTCATAGTATAGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009694.3-336s21c1
Sequence:CCGGGTGGTCGAAGTACAGAGTAAGCTCGAGCTTACTCTGTACTTCGACCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009694.3-309s21c1
Sequence:CCGGGGGCGGAATAAGACCTTTCTCCTCGAGGAGAAAGGTCTTATTCCGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009694.3-282s21c1
Sequence:CCGGCAGTTCCGGAACGTGGAATACCTCGAGGTATTCCACGTTCCGGAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009694.3-510s21c1
Sequence:CCGGTGCGCTGACCGGATTCTCAAACTCGAGTTTGAGAATCCGGTCAGCGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009694.3-223s21c1
Sequence:CCGGATCTTCCGCCCTTCGAGATTGCTCGAGCAATCTCGAAGGGCGGAAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009694
APOBEC2 MISSION shRNA Lentiviral Transduction Particles
apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009694.1-868s1c1
Sequence:CCGGCCTGGCTTCCTGATTCTACTTCTCGAGAAGTAGAATCAGGAAGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009694.1-160s1c1
Sequence:CCGGGCCTCTCAGAATGGAGATGATCTCGAGATCATCTCCATTCTGAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009694.1-258s1c1
Sequence:CCGGGCTACCAGTCAACTTCTTCAACTCGAGTTGAAGAAGTTGACTGGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009694.1-753s1c1
Sequence:CCGGCTTCCTATACTATGAGGAGAACTCGAGTTCTCCTCATAGTATAGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009694.3-336s21c1
Sequence:CCGGGTGGTCGAAGTACAGAGTAAGCTCGAGCTTACTCTGTACTTCGACCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009694.3-309s21c1
Sequence:CCGGGGGCGGAATAAGACCTTTCTCCTCGAGGAGAAAGGTCTTATTCCGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009694.3-282s21c1
Sequence:CCGGCAGTTCCGGAACGTGGAATACCTCGAGGTATTCCACGTTCCGGAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009694.3-510s21c1
Sequence:CCGGTGCGCTGACCGGATTCTCAAACTCGAGTTTGAGAATCCGGTCAGCGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009694.3-223s21c1
Sequence:CCGGATCTTCCGCCCTTCGAGATTGCTCGAGCAATCTCGAAGGGCGGAAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)