EMAIL THIS PAGE TO A FRIEND

APOBEC3A

apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3A

25 Gene Product Result for
Synonyms: A3A ARP3 PHRBN bK150C2.1
UniProtKB ID: P31941, A0AVM1, Q12807, Q5JZ93, Q9UH18
Gene ID:
Human(200315) Summary: This gene is a member of the cytidine deaminase gene family. It is one of seven related genes or pseudogenes found in a cluster, thought to result from gene duplication, on chromosome 22. Members of the cluster encode proteins that are structurally and functionally related to the C to U RNA-editing cytidine deaminase APOBEC1. The protein encoded by this gene lacks the zinc binding activity of other family members. The protein plays a role in immunity, by restricting transmission of foreign DNA such as viruses. One mechanism of foreign DNA restriction is deamination of foreign double-stranded DNA cytidines to uridines, which leads to DNA degradation. However, other mechanisms are also thought to be involved, as anti-viral effect is not dependent on deaminase activity. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2012]
dog(610245) apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3A
dog(610077) DNA dC->dU-editing enzyme APOBEC-3G-like
cow(507162) apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145699 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145699 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145699 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU031571 MISSION® esiRNA esiRNA human APOBEC3A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145699 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145699 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191706 predicted 525
2 SASI_Hs01_00191707 predicted 206
3 SASI_Hs01_00191708 predicted 529
4 SASI_Hs01_00191709 predicted 101
5 SASI_Hs01_00191710 predicted 795
6 SASI_Hs01_00191711 predicted 82
7 SASI_Hs01_00191712 predicted 101
8 SASI_Hs01_00191713 predicted 1166
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145699
APOBEC3A MISSION shRNA Bacterial Glycerol Stock
apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145699.2-232s1c1
Sequence:CCGGGCTTTCTACACAACCAGGCTACTCGAGTAGCCTGGTTGTGTAGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145699.2-538s1c1
Sequence:CCGGACGATGAATTTAAGCACTGCTCTCGAGAGCAGTGCTTAAATTCATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145699.2-119s1c1
Sequence:CCGGACACATATTCACTTCCAACTTCTCGAGAAGTTGGAAGTGAATATGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145699.2-105s1c1
Sequence:CCGGCACTTGATGGATCCACACATACTCGAGTATGTGTGGATCCATCAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145699.2-136s1c1
Sequence:CCGGACTTTAACAATGGCATTGGAACTCGAGTTCCAATGCCATTGTTAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145699.3-1200s21c1
Sequence:CCGGCAGTACCAGACTCCATCTCAACTCGAGTTGAGATGGAGTCTGGTACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145699.3-293s21c1
Sequence:CCGGCAATGGCACCTCGGTCAAGATCTCGAGATCTTGACCGAGGTGCCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145699.3-883s21c1
Sequence:CCGGAGACGCCAGCAAAGCAGTATGCTCGAGCATACTGCTTTGCTGGCGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414515    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145699.3-896s21c1
Sequence:CCGGGCAGTATGCTCCCGATCAAGTCTCGAGACTTGATCGGGAGCATACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145699
APOBEC3A MISSION shRNA shRNA Plasmid DNA
apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145699.2-232s1c1
Sequence:CCGGGCTTTCTACACAACCAGGCTACTCGAGTAGCCTGGTTGTGTAGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145699.2-538s1c1
Sequence:CCGGACGATGAATTTAAGCACTGCTCTCGAGAGCAGTGCTTAAATTCATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145699.2-119s1c1
Sequence:CCGGACACATATTCACTTCCAACTTCTCGAGAAGTTGGAAGTGAATATGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145699.2-105s1c1
Sequence:CCGGCACTTGATGGATCCACACATACTCGAGTATGTGTGGATCCATCAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145699.2-136s1c1
Sequence:CCGGACTTTAACAATGGCATTGGAACTCGAGTTCCAATGCCATTGTTAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145699.3-1200s21c1
Sequence:CCGGCAGTACCAGACTCCATCTCAACTCGAGTTGAGATGGAGTCTGGTACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145699.3-293s21c1
Sequence:CCGGCAATGGCACCTCGGTCAAGATCTCGAGATCTTGACCGAGGTGCCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145699.3-883s21c1
Sequence:CCGGAGACGCCAGCAAAGCAGTATGCTCGAGCATACTGCTTTGCTGGCGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414515    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145699.3-896s21c1
Sequence:CCGGGCAGTATGCTCCCGATCAAGTCTCGAGACTTGATCGGGAGCATACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145699
APOBEC3A MISSION shRNA Lentiviral Transduction Particles
apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145699.2-232s1c1
Sequence:CCGGGCTTTCTACACAACCAGGCTACTCGAGTAGCCTGGTTGTGTAGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145699.2-538s1c1
Sequence:CCGGACGATGAATTTAAGCACTGCTCTCGAGAGCAGTGCTTAAATTCATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145699.2-119s1c1
Sequence:CCGGACACATATTCACTTCCAACTTCTCGAGAAGTTGGAAGTGAATATGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145699.2-105s1c1
Sequence:CCGGCACTTGATGGATCCACACATACTCGAGTATGTGTGGATCCATCAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145699.2-136s1c1
Sequence:CCGGACTTTAACAATGGCATTGGAACTCGAGTTCCAATGCCATTGTTAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145699.3-1200s21c1
Sequence:CCGGCAGTACCAGACTCCATCTCAACTCGAGTTGAGATGGAGTCTGGTACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145699.3-293s21c1
Sequence:CCGGCAATGGCACCTCGGTCAAGATCTCGAGATCTTGACCGAGGTGCCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145699.3-883s21c1
Sequence:CCGGAGACGCCAGCAAAGCAGTATGCTCGAGCATACTGCTTTGCTGGCGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414515    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145699.3-896s21c1
Sequence:CCGGGCAGTATGCTCCCGATCAAGTCTCGAGACTTGATCGGGAGCATACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)