EMAIL THIS PAGE TO A FRIEND

APOBEC3B

apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3B

51 Gene Product Result for
Synonyms: A3B APOBEC1L ARCD3 ARP4 DJ742C19.2 PHRBNL bK150C2.2
Gene ID:
Human(9582) Summary: This gene is a member of the cytidine deaminase gene family. It is one of seven related genes or pseudogenes found in a cluster, thought to result from gene duplication, on chromosome 22. Members of the cluster encode proteins that are structurally and functionally related to the C to U RNA-editing cytidine deaminase APOBEC1. It is thought that the proteins may be RNA editing enzymes and have roles in growth or cell cycle control. A hybrid gene results from the deletion of approximately 29.5 kb of sequence between this gene, APOBEC3B, and the adjacent gene APOBEC3A. The breakpoints of the deletion are within the two genes, so the deletion allele is predicted to have the promoter and coding region of APOBEC3A, but the 3' UTR of APOBEC3B. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2012]
Rat(315137) apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3B
cow(504505) apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3B
dog(481248) apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004900 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004900 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004900 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU114551 MISSION® esiRNA esiRNA human APOBEC3B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004900 Rosetta Predictions human pricing
NM_001033703 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004900 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190880 predicted 233
2 SASI_Hs01_00190881 predicted 616
3 SASI_Hs01_00190882 predicted 535
4 SASI_Hs01_00190883 predicted 1075
5 SASI_Hs01_00190884 predicted 702
6 SASI_Hs01_00190876 predicted 636
7 SASI_Hs01_00190877 predicted 650
8 SASI_Hs01_00190878 predicted 486
9 SASI_Hs01_00190879 predicted 652
10 SASI_Hs01_00190885 predicted 760
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033703 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119592 predicted 1095
2 SASI_Rn01_00119594 predicted 846
3 SASI_Rn01_00119595 predicted 876
4 SASI_Rn01_00119596 predicted 569
5 SASI_Rn01_00119597 predicted 1001
6 SASI_Rn01_00119598 predicted 997
7 SASI_Rn01_00119599 predicted 866
8 SASI_Rn02_00203742 predicted 856
9 SASI_Rn01_00119600 predicted 787
10 SASI_Rn01_00119601 predicted 467
11 SASI_Rn01_00119593 predicted 239
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004900
VALIDATED
APOBEC3B MISSION shRNA Bacterial Glycerol Stock
apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004900.3-562s1c1
Sequence:CCGGCCTTGGTACAAATTCGATGAACTCGAGTTCATCGAATTTGTACCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004900.3-693s1c1
Sequence:CCGGGACCTACTTGTGCTATGAGGTCTCGAGACCTCATAGCACAAGTAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004900.3-84s1c1
Sequence:CCGGGCGGATGTATCGAGACACATTCTCGAGAATGTGTCTCGATACATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004900.3-602s1c1
Sequence:CCGGGCACGCTAAAGGAGATTCTCACTCGAGTGAGAATCTCCTTTAGCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140546    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004900.3-1324s1c1
Sequence:CCGGGCAAAGCAATGTGCTCCTGATCTCGAGATCAGGAGCACATTGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004900.3-627s1c1
Sequence:CCGGCCTGATGGATCCAGACACATTCTCGAGAATGTGTCTGGATCCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004900.3-225s1c1
Sequence:CCGGCCAGGTGTATTTCAAGCCTCACTCGAGTGAGGCTTGAAATACACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004900.3-1047s1c1
Sequence:CCGGCCAAGTCTCCATCATGACCTACTCGAGTAGGTCATGATGGAGACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004900.3-834s1c1
Sequence:CCGGCCTGGTTCCTTCTTTGCAGTTCTCGAGAACTGCAAAGAAGGAACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004900.3-690s1c1
Sequence:CCGGCCAGACCTACTTGTGCTATGACTCGAGTCATAGCACAAGTAGGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004900
VALIDATED
APOBEC3B MISSION shRNA shRNA Plasmid DNA
apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004900.3-562s1c1
Sequence:CCGGCCTTGGTACAAATTCGATGAACTCGAGTTCATCGAATTTGTACCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004900.3-693s1c1
Sequence:CCGGGACCTACTTGTGCTATGAGGTCTCGAGACCTCATAGCACAAGTAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004900.3-84s1c1
Sequence:CCGGGCGGATGTATCGAGACACATTCTCGAGAATGTGTCTCGATACATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004900.3-602s1c1
Sequence:CCGGGCACGCTAAAGGAGATTCTCACTCGAGTGAGAATCTCCTTTAGCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140546    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004900.3-1324s1c1
Sequence:CCGGGCAAAGCAATGTGCTCCTGATCTCGAGATCAGGAGCACATTGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004900.3-627s1c1
Sequence:CCGGCCTGATGGATCCAGACACATTCTCGAGAATGTGTCTGGATCCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004900.3-225s1c1
Sequence:CCGGCCAGGTGTATTTCAAGCCTCACTCGAGTGAGGCTTGAAATACACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004900.3-1047s1c1
Sequence:CCGGCCAAGTCTCCATCATGACCTACTCGAGTAGGTCATGATGGAGACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004900.3-834s1c1
Sequence:CCGGCCTGGTTCCTTCTTTGCAGTTCTCGAGAACTGCAAAGAAGGAACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004900.3-690s1c1
Sequence:CCGGCCAGACCTACTTGTGCTATGACTCGAGTCATAGCACAAGTAGGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004900
VALIDATED
APOBEC3B MISSION shRNA Lentiviral Transduction Particles
apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004900.3-562s1c1
Sequence:CCGGCCTTGGTACAAATTCGATGAACTCGAGTTCATCGAATTTGTACCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004900.3-693s1c1
Sequence:CCGGGACCTACTTGTGCTATGAGGTCTCGAGACCTCATAGCACAAGTAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004900.3-84s1c1
Sequence:CCGGGCGGATGTATCGAGACACATTCTCGAGAATGTGTCTCGATACATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004900.3-602s1c1
Sequence:CCGGGCACGCTAAAGGAGATTCTCACTCGAGTGAGAATCTCCTTTAGCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140546    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004900.3-1324s1c1
Sequence:CCGGGCAAAGCAATGTGCTCCTGATCTCGAGATCAGGAGCACATTGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004900.3-627s1c1
Sequence:CCGGCCTGATGGATCCAGACACATTCTCGAGAATGTGTCTGGATCCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004900.3-225s1c1
Sequence:CCGGCCAGGTGTATTTCAAGCCTCACTCGAGTGAGGCTTGAAATACACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004900.3-1047s1c1
Sequence:CCGGCCAAGTCTCCATCATGACCTACTCGAGTAGGTCATGATGGAGACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004900.3-834s1c1
Sequence:CCGGCCTGGTTCCTTCTTTGCAGTTCTCGAGAACTGCAAAGAAGGAACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004900.3-690s1c1
Sequence:CCGGCCAGACCTACTTGTGCTATGACTCGAGTCATAGCACAAGTAGGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks